Loxodonta_africana Locus Mono:88:SNORD65
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:88:SNORD65
Loxodonta_africana
Mono:88:SNORD65
GeneScaffold_6116
SNORD65
1001..1073
2073
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGCATTGGCCTACTGTGAGGTAAGTGTTTGTCTAGGAGGTAGGTTA
GTGGTTGTATGTACCTAGCTTGTTAAATAGTTAATTCACGTGAAAGTGCTGCTCTGATAG
GTCAGATACTGGCAGTTTCACAAATCTGTGTAGGCCTTGACCCTTAGAGTACCCCTGAGC
CATCCTGACATGGATCTGTGGTGGCGGTGAAGCCACTGTGCAGAGCACAGGCAGGAGAGG
TTCCTGTTTTATCCCTCTGCTGCATGATCTTGAGCAAATGACCTGTCTGCTAGATGTAGT
TTCTTTCGTCCATGATAACCTTAGGCTTCTGAGGCTTAAAACAAGGTGGCCAAGTGGAGG
TCACAGACCTCAAGGAAGTGAATTAGGATTTGTTGACTTGGGTGATTAATTCACAGAAAA
ACAGCTCTACTAAGTGCTTTTTGAGCACTCTTGTTAGCCCAGACTTTTCATTTGTACCTG
AGGCTACCGTCATCAGAAATGCCCCCTGCTCTGCCCTTGGTGTGTCTGAGGTGTGTGTCT
TTCCACTTCCCCAGGGTTGACAACTGAGTGCTAGAGAATGGGACCTGAAGTGCGAGAGTT
TTAGAGCAACCTGGGAGGTAAGCCTTGATCCTAGACAACCAACCACCACGGTGGAATAAA
TGAAAAGCAAGTGTTAAAACTGATGTGCGGAAAAGGATATCACATGATGAGATAACCCAA
AATAGCTGGAATTACCGGCAGAGTGTGTAGTGGTGAACCTGTGGTTTTCTGAAGATACCT
TACATGCTGTGATTGAAAGCTGGTTGAAGCGGAAAGTGAGACTGATACCTAGTTTCTTTG
CAGGCTGTGTTCCCAGATGATGACCAGCTGCAGCAGGGGCAAAATGCAGTCCAGGAACCT
GGGGCCACCACGAACTTGGACTCAAAAGCTCTGCATTTGATCTGACACTGTGAAACACGC
TCACTGGTGAGTATCAGCTGAAAATGTATCTGGCAACTTTTTTCCTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
TTCTTGTCCGGGCCTCTGCTAAAAGATTTGGGCAAGGGGAAGGTGTAGGGTGAAATCCTT
TTTTTGGGGGATGCTTTTTTCAGTTTACCTCCTTCCTCCCTCCCCATCTATCTTATGGAG
GCCCCATCTTAGAGTATAGGTTTGGAGAGCCTTAATATTGTATGAATGCTCAAAGGGTTA
CCTCCAGGGATTCCCAGAAATTTTGTGGAAAATAACAGAAACGGTTACTGTTTGAACTGC
CCAGGAGGAGTAAGTCCTGCCCTGGCAGTTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved