Loxodonta_africana Locus Mono:61:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:61:SNORD115
Loxodonta_africana
Mono:61:SNORD115
scaffold_179124
SNORD115
1001..1081
1542
GACACAGATTTGGCTTCCTTGTAGACATTAGCCGGGGCTGATTTAATGAAAAGCCTGTT
CTTGGCTGGGACTGCCTGAGTATTTTTCTCCATTCGGAGCCCTCTACGCCTTGTCTTGAT
CTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAACGGGCCAGAAGTGTG
TGTCTTGATTTTGTCCCTATTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATG
AATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTTAAAGGATTGCAAGGTC
GAAGCCTGTTTTACTGCTTTCCTGAGGGTCAAGCTACTCCCCGGGACACCGGAAGAGGAT
GTGCGAACCTTCTCCTCCTGCGTGATTGCGGGCTGGAAGGACGATGTCAGTGGTGAGGAC
CTTGAGGACTCAGGTGATTTTTCCCGGGGTTTGAGATGTCTCGGGTCAATGAAGACACCT
CAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCACAATAGGATCACGCTGAGG
TCCAGAGAGAAACTCCTTTTCCCCAACGTTAATGATCTCCTTTAGAGTGGATCCCCGTTT
TGATCCCTTTTTCCATCACCAAGTGATCAGAAACTCCTCCCTGACCGATTTTTGTCATGC
TGATTCCTTGGCTCTTTTCCTCTTTGTCTGTGATTTAGAAAGACCTGCTTTCAAGAGGTT
CACCACCCGGAAGAACTCAAAGTGAGTGAATGACGGCGGTTTTCCCTTGTTCCCTGGGGA
TACCTAGACAAGTGAATACGGAGCCCAAGAGGCAGTCGGGTTTTGTTAAAAGGCTGAGAC
GTGTCCCCTGCCTTGAGCTTGACCTGACCGATTGACCAAGGGGTGGTGATATGCACGGGT
GGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCC
GGTTCCCAGTCGGGTATGTCTACGGAATTTTGAGAATATTTTCAACTCTCAACTATTTAC
GCGATGGGAGTGTCTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAG
CCTGTGTCAGTGGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGG
TATTGGGTGAAGAACTGAGTAGCCTGACACCTCGTTGTAGCATTCAAGAAAAGGCAGCAG
CACCAATATTTGAGTCAGAAAGCTAATGTCAGGTTCAATACCATTCGGTAAGTGGGTCGC
GAGCGTCACGACTAGTTTCAGGTTCATGCCACAGGAGGTCAGGATCTGCTGAGAGTCTAA
TCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGA
TCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTC
TGATGCTTGATATACAGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGT
AGATTCGATTGCGTCTCTCCATGGCTCAGTGGTGAAATGAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved