Loxodonta_africana Locus Poly:2:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:2:SNORD115
Loxodonta_africana
Poly:2:SNORD115
scaffold_9943
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2695..2775, 4394..4471, 6093..6173, 7796..7873
8873
NNNNNNNNNNNNNNNNNNNNNNNNGAAAAGGCAGCAGCACCAATATTTGAGTCAAAAAG
CTAATGTCAAGTTCAATACCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCGTTTCAGG
TTCATGCCACAGGAGGTCAGGATCTGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTG
CTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATT
CCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGA
GATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCAT
GGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGA
ATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGC
TGGGGACTCTTGCGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACA
CATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAATATT
GCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAG
TTTCTCTTCTGGGACCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGAT
TCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACC
GTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTA
GGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCC
CCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATA
CTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCC
AAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCA
GATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAAT
TGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAA
TCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGG
TAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGG
GACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGC
TCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCT
ACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGG
AATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGA
ATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATG
CCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTC
ATTTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCTGGAAGTGCTCGTGCACG
GATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGAGGCTGATCAAA
TGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTAT
GCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATG
GGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAG
CTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAA
GGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAA
ACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATAT
CGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTC
GACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAG
GATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAG
GGGACCCCCGTTTGGATCCCTGTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCG
ATTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTG
CTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGCTTTCCCTT
GTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGA
AAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGA
TATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATT
TTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCT
CAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCC
CTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCC
AGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGA
AAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGT
ACGTGGGTCGCGAGCATCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGC
TGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATT
TTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCC
ACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTG
GGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGGGGTGAAATGAAAGCGTTGA
AGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAA
TGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGAACTCTTGGGTGTCATTTCCCGG
GAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAG
TCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTCTGCTAC
ATCCAGAGACCTCTATGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGT
CAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAAT
GTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACT
GATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGT
CAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTC
CTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGG
GAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAA
AAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTC
CAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAA
AAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGT
CCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTT
CCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGC
AGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGT
TGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACAT
GTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGG
AGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCA
GAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGG
ACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGT
AGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAA
ATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAG
GTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGT
GCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAG
GTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGA
GGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTC
CATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCT
TGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCCCAGTTTTGGGAAC
CCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTC
GGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGAC
TTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTC
TGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTC
GTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGT
CTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTT
CCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTC
TCATCCTGCGTGATTGCGGGACTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTC
AGGTGATTTCTCCCGGGGCATATGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTC
TCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAG
AAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTT
TTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCCT
TGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCG
AAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACA
AGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTG
CTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAG
GAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGT
CGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAG
TGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAG
TTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGA
AGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATC
TGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATG
ACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATG
CAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAAT
CTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGA
TATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATT
GTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGGAAGGACTGTGGCAATTTTAAC
AAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAA
GATCCCCCGGTGCTGGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGAC
AGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCA
AAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCC
TTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGG
TTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGC
CTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGG
GTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAA
ACTGGAAGATGATGTGTGAACGCATCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACA
TTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGT
CAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGG
TTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCACTTCCAGAATCTTGTTTAGAG
TCCGGACTCGGACCATCTGTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGG
GTGGCCGATTTTAGGTCAGGCTGATTCCTTGGCTCTTTTCCCCTTTTTGTGTCCTTTAGC
ACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGAT
TTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGT
TTGCTGACAAGGCTGAGGCATGTGCCCTGGTGTTTGCTTGACCTTGTCTGGTTGACTAAG
TGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTG
GAGTCATCTGCGATAGCCTGGGTCCAAGTCCGATACGGCCTACCGAAATGGGAGAAACGG
CCAACTAGAAGAATGTATTTTCCGAAGATATGTATGAAATGTGAATGGCTCAGATCTCTA
CAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAG
GATTTGCAGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGAT
AGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCGTAGAAAATCTAAAG
TCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGC
CACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTT
GCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATA
AGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGT
GTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved