Loxodonta_africana Locus Mono:82:SNORD95
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:82:SNORD95
Loxodonta_africana
Mono:82:SNORD95
GeneScaffold_4057
SNORD95
1001..1067
2067
CGGTCCTCCCGATCTACTTCCCTGAGCGGCGTTCTGGCATGAAAATATGTTACGGTTTG
AGAGTTCACCTGAGCATGGTTCGAAAGTTTATAAGTTTCTTTAATACGGCTTTTTTCCCC
CAAATTGCCCACAGGTACTCACAGTTGGGACCTCGAAATTAAGTACCCGCTTCATTGTCC
TCTGAACTACCAAGCGGAAAGGGCGGGGCTCGCGTTGTGCCACCTAGCGGACGGTGAAGC
CGTAAGGCGATCCTCATGGGAATGTGCCGTACATTTCAACTCTTTCACGTCTAAGAAATC
ACACCCCAGCAAAGGTTTAAGGAACCTCTTTAAATATTCGGTCGTGATAGTTTCAGAGTG
TATTCGTGCGGAGCTGTCAAAGTATGTTGCGTGGCGGAGGGGACGTGTCGTGCGATTTCA
ACAGCTGTTTCGGCTACATGGCGCTGCCATCTTAAGCAGAAGTGAATCATGGGAGCCACC
ATTTTGGTCGGGCGGGCGGGTATTTCCGGTTCCGGCAGTGGGTTCCTCGATCTTTTTCTA
CGCAGGGCCGCGGCCAGAGCGCCGGTGCTGCTGGTCTCTCTGAGCTATCTGGTGCCATCC
TCGTCGCTGCGGCGACCCTCGCACCCGCCGCCGTCATGACTGAGCAAATGACCCTTCGTG
GCACCCTCAAGGGCCACAACGGATGGGTTACCCAGATCGCTACCACTCCACAGTTCCCGG
ACATGATACTGTCTGCCTCGCGAGGTACGTACTAAGGTGCAGGAGGAGGGTTGCGCGCCT
TACGAGGCTGGGCTGTGGTGCGCGAGTCGCGGGTCCGAAAGACTCCGCCGGGGTTTGAGG
GGGGACATGTGACCCGGCTGAGCCCGGTAAGGCATTCCCATCATTGCTAATGAAGTACCG
AGGAACAGCCTGTGGCCGCCAGGAGGGTGGGAGGTTTCTTTATAGCCTTCACGCTTCTGC
ACGGTGTAGCTAGTTGTGCCCACGAGCCTACAGGCCTGGCGGAGCGGTGATGATTACAAC
ATGCCATCTGAGCATAGGTGCTGAGACCCAGAGGCTGTTTCTGAGCTGTCGCCCGGCCCT
CGGCTCTTTTGGGAATTGGTGGTCTCCAGGGGAGCTCCATGGCACAAACCTGGATTTGAC
CGGCACCTACTCTATGCCCTGGCTTCTCTTCCTCACATTCTCGGTCGGCCTGAGTGCGTT
TGGAGGCTTCCTGTGCTTTCCAAATGCTCCCACACTGGGAGTTTTTTGAAGCTAGGATTA
GGGCTGGCCCTTAATTGTAAAGTTTATAGTGTAGGACACGTTTTAGTGAAATCATCCAAC
CCTGTAGCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved