Loxodonta_africana Locus Poly:33:SNORD38
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:33:SNORD38
Loxodonta_africana
Poly:33:SNORD38
GeneScaffold_2282
SNORD38, SNORD55
1001..1070, 2894..2973
3973
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCAGGGTTTGATGAAGG
CTGGATGTGGAGACCTTTCCTGAGTTAGGATTTTGGGGCCCCAGCTAACCAACACTTCTG
TATCCCTCCTATTCAGACTCCTGAGGAGGAAGAGATTTTAAACAAAAAGCGATCAAAGAA
AATTCGGAAAAAATACGATGAAAGGAAAAAGAATACAAAAATCAGCAGTCTTCTGGAGGA
GCAGTTCCAGCAGGGCAAGCTTCTTGGTGAGATGGCTGTTGCATGGGGGAGGGGTGCACA
AAGGTATGGTGTGATTGCCAGCCATATGGTCTAGGGTTCACCAGGAGAGTTGAATGCCTA
AGGTAGCCACACCATTTACTGTTCTGAGACTTCTGAAATCGAAAGGGGCGCTGTTAATGA
TACCAAGATAACCAGCACGAATCAGCGTGTTTGGTCACCCCATTAGTGAGAAGCTAAAAT
GGAAAATGTTCGTTAAGAGTCCATAGGCTTGTCCTTGGAGCATGTCCTCTGCCTCTGGGT
TTCATGGTTTCGAGAAGTGTATGCCTAGGCTGAGGGGGCCGTCTCAGTGATGAAAACTTT
GTCCAGTTCTGCTACTGACTTTACTTGATGATAAAGTATTATCTGAGGAGACAGTGGGCT
TCATGCTTGCCCTCAAGGTACCTGAGCCAACGTGGAGTTCGAAGGGGATAGGTTTGGGTG
AGGCCACGTTATCATTTTGCTAAGGACCACGTCCTCTCTTACAGCGTGTATCGCTTCGAG
GCCAGGCCAGTGTGGCCGAGCAGATGGCTATGTGCTAGAGGGCAAGGAGCTGGAGTTCTA
TCTGAGGAAAATCAAGGCCCGGAAAGGCAAATAAATCCTCTCCCCTCCCATGTTAGCACA
TGTATTAAAGGTGTTTATTCTATATCTTGCGTTCACGTTGTCTGAATATCTGACTTCTCT
ATTTGGTTCCCTGTGCTGAACAAAATAGATGTAGCGATGGCTGGAACTAGATTCCCACAC
TTCTACTATCCTGTCGCAATTTCAGCCCTACTAGAGTGCTTCCTTGGCCCCAACCCCCTC
GCCCTGAAGGCTAGGCTTGTTTTGTGGACTGTGCCTTTCTGAAATTGGCAGAACATTTCT
CATCCTAAAGGCCTGTTTCAGTGGGAATAAAGGAATGCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCAGTGTTCATTGCAGCACTTTTCCATTATAGCCAAAAGGTG
GAAACAACTTAAATTGTCCATCAACAGATGAATGGATAAACAAAATGTGGTATATACATA
CAATGGAATATCCTGAAGCCATAAATAGAAAATGTAGTTCTGATGCATGCCACAACATGG
ACGAACTTTGAACACATTAAAAAAAAAAAAAAAATTATGCTGAGTGAAATAAGCCAGCTA
CAAAAGGGCAAATACCTTACAATCTCACTTACATGAAATAAGTAAATACTGCACATAGAA
ACCAAAGATTATTAACGGTTACCAGAAGTAGGAGTAGGAGGGAGGGGAGAAGAGGTTTTT
TTTGGGCGGGGGGGGGGCATTGAGTTTATGTTAATGGTGGTGTAATATTTTGGAAAAGGA
TACTGATAATGGTGGCACAATATGAAAAATGTAATCAGTGTAACTGAATTGTGAATGTTG
AAGTTGTGTTGGCGAATGTTTTGGTGTGCATATTTTAGCCACGATATTAAAAAAAAAAAA
TCCATCATTCGTTTCCACCTCTATTGCCTTCCACCCTTTCCCAACGCACACATCTCTCAT
CTTGGACTACTGCTATAGACTCTTACACTAGTCTCTCTAAAAACGTAAACAAAACCATGG
TACTCTACTCCGTTGTGCCCTGAAGCCCTCAACTTCTACCGAAAGCTTGCACATTTGTCG
ACCCCGCAGGATCCGCCCACCCAGCCTTTCCCAAAAGGGTTTCAGAGATTTGAGAGCTAA
GCGGGCTGAGGGTTCATCGGGCACAAGGACCCTCCCCGCCTTTGGTGCATTTTCGTCGCA
GTCTCTAAAGCGTCAGTAAAGTCGTAGTCCTGGCCATTTTAACGGCGCCCGGAATGTACG
TAAAGGGGGCGGGACTACGTTTTACAAACCGGACCGTGAAGCTTTGCGTTTTCTCTTTCC
AGCCAGCGCCGAGCGATGGGTGAGTCTCGCTGTGTGTTGCGGCCATGATGGGGGGGTGAG
TTCAATCGGGCGCCATCCTCATTAGCAGCCAAGTTAGGAGTGCTGGCGCCCCGGTGCCCG
GCAACGAACAGCCATGAGAAGGGGCGGTCCGCAGGTTTTGGCCGGCGAGGTCCGCGCCGG
GGGCTGCAAGGTCGCTGGATTGCCAGCTGCACCAACATGGCTGCCGCGGGAAGGGAGATC
CGGGCTGGGCCGCACGTGCATGATGACACCTCGGTAATGCTGCAAATCCCCGAGTGCGCG
GTGGGGAAGCCAACCTTGGAGAGCTGAGCCCGCGGTCCGTCCGGCGAGTGGGTTCTGGAG
CTGGTGAGGCCCCGGGTCCCAGCACCTCAAGCTTCTGCCCTTGACCTCATACATAGGCAT
CTCTCGGGACAACTGGCACAAGCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved