Loxodonta_africana Locus Mono:34:SNORD58
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:34:SNORD58
Loxodonta_africana
Mono:34:SNORD58
scaffold_63455
SNORD58
1001..1063
2063
TCATCTTGGGCATGGTATTAGTTTAAATTGGAGAAAGTGGTTAATTGTCTCCCTTCATT
TTCTTTTCAGGCCAAGCAGTGGGGTTGGACACAGGGACGGTGGCCCAAAAAGAGTGCTGA
ATTTTTGCTCCACATGCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGGTAACCAAACT
ATTAACATAACTGTGTGCGTGCAGCTTGAATAATACTGCTGTTGTCCAGGTTTATTTCTC
AATTGTTTTGTTCTTTTAGTAATTAGATTTCACGTAGAGTGGTCTGGGGTCTCTTCAAGC
CTATCCCTTAACCCCAGGCCTGGGGAAAGATTTCTCCTGTCTTTTACACTGGAAGTATTT
CACCAAGGGTTCATAAGTGTTTCTGTGCCATGGGCCTTTGTGGTACTATGGTGGTTCATG
AACCTTTGTGGGATACTTTTAAATAAAAGTGGTAAATGTATATAGGATTACAAAAGAAAG
TTAGGAAAACGTTTACATGTGGATGGACTTCTTGATCATTAACTTCCCATAACAATATCT
AGTAGTGTGTTGAAGGACCCTTAGAGTAACAGTGAAAGCACACACTGAACTGTCACGCTA
TTTGAATTCTTATATTGCCTTTTGGAAATGATGAAGGCAGGGATTTGGTGGCAGGATTCG
GAATTGGTGTTTTTCAGTGATTGAGTTTGTGGTGTTTGTTTAAAGATGATCAGATCAGCT
GATTTTGTTTTGTTCTCTCTGCACCGTTCCTTCCTAGGGTTTAGATGTAGATTCTCTGGT
CATTGAGCACATCCAGGTGAACAAAGCCCCCAAGATGCGCCGCCGTACTTACAGAGCTCA
TGGTCGAATTAACCCATATATGAGCTCCCCTTGCCACATTGAGATGATCCTTACCGAAAA
GGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCACAGAAGAAAAAGGTAAATTACTT
AGTTGCTCTGTTTGAATTGTGTATACTAGGAAGATTGATGGTTGCTGTGATGACTATCTT
AGGACACCTTTGGAATAACCATGAAAGAAAACATTCTGAGCAACTTCATTCACCTGTCTG
TCTGTGGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved