Loxodonta_africana Locus Mono:29:SNORD116
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:29:SNORD116
Loxodonta_africana
Mono:29:SNORD116
scaffold_52113
SNORD116
1001..1092
2092
CTTTTCCCCTTTTGGCTTTGGGATTGTGCGTCAGGAGGAATTGGAATTTGAAGTCAGAC
TGCAGGATGGTTGTATGGCCTCCCTTCGTGTGGTCAGGTCAGTGGTAACATTTCTGTGCT
GCCACAGCATTAAAGTTCAAAGAATGTGAACAGGTAGGTAAAATGGGAATGGGCCCAACT
CCCTGATGGAGAGTTGAGCCTCCAATACCGTGCCTACTAATTGAGCTCTTGGCTGAGGAT
TTTGCCTCTGTAGATAGGGCATTTTTTATTAGTATGATGCGCAGTTGGCCAATTTGAATC
AGGGTTGACCTTGTAAGCCTGGCAGCTTTTGCATCTTGTCCTATTTGCCAGGGGTGCTGC
ATATTATTGCAGTGTCTATATTCTGGGTTGCTCGTAAGAGTCTTATCAAGGGCAGTTCAG
TTCTGATGTCTTTCAAAGATACAACGTAGGTGTCACTGTCAAACTCATTTTAAGGTAGAA
ATTAGAGAAGGAGGCGGGGTGCGCAACTTCTAAATACACTTGTGTGCACAAGCACACATA
CATATGTGTATGATGTCACTGATACGTACACACATGCCTCCATCCATACTAAGAGCTAAT
GAAGTATAGCTGCAGGCTATCCCTCATGACTGTTGCCTGTAATGTACCTGCATATGAATC
TCATAAGTGCCTGTCTTTCCTCTTACTTTTTTTAGATGGAGATTTTCTGGAATGAAAGCC
AAGTGGATTAAAGGAAATTCCAGATTGTATTTCAGTCCTACAGAGTGGAGAGAGTCATTG
GACTAATGGTGGTATTGGGTCTGAACACAGGCATTGGATCGCCGAGAGCAGGTCAGTATA
TTCGTGGTGTAATGGACCAGAATTCTCAAGTGGATTCAGTAGACCCACAGTGACCTGTTT
CTTCTCATACGCTAAAGGCATGCAGAGTTTCATGTCTTGAGTGGATTGACTCCTGTGTTC
GTTCAGTGCCTTAGCCCAATTCAGTGGTTAAGAATGTACTTAGATCAATGATGAAATCCA
TATATACATTCCTTGGAAATCTGAACAAAATGAGTGAAAAACCCCTACCGTCTTGCTCAT
CGACCTGAGGTCCACATTGTCTTATACTGGCCAATACATGAATGAGGGACAACATTCATT
GGCTCCCCTTTGTGGCTCCACATTCTGCCAGAACTTCTGGAAGTTCCCAGTTTTGCACAT
AGGACGACATCTAGTCCTACACCTCATTGAGTAGCAGATTCCCTGGTGGATTGGCCCCCC
TTTGAGGGCAAGGTAGCCCACACGTGTACAGGTGGAATGAGCAAATGAGTGAGTGAGCAG
GCAGCATAGGTCCCATGATCCTGCAGCATGGTGTCTGTTGGCTTTTTTTTTCTGTCCTTC
AGGCATATCCTCTAGGTGCTAGTTCCTACTATGAGGAAAGAGGGCCTTATAGGCAATGCT
TAGAGTCTCATGTCATTCAGTGAGGATGATCTTTTGACGTTTATTTATTGTGCAAGTAGA
ATGAAAAACAATACGTGATGGTCATGTAGCTGTATTCATTTCACCGAAGAACCAATCCAG
TCACATGGTTTCAGATCATTGCCTTGTCTGTCCTATGGCAACATGCCTTGGCAACTATTG
TCCAAGGGAAGGAGTAAAGAGGGAGAATCATTTGTAAAGTGTTTAAGTGTCCTAAAGTGT
GTTTGGCGGAGGATTTTTTTTCCTAAGGTTGCCCTAGGTGTTTCTGTTTTTTTCTTTTTA
TAAGATTGTCTTAGGTGTTTCTGTACTTTCCAACTTGGAAGTGAGGAGTTTGAGATACAG
TTCCTGGATGGGAATGTGTGGATGTTCATGAGTGGGTGTAATTTGGCCTCCCTCCTTTAA
TAACCTACTGTGTATATTTCTGAGTTGTTAGTTTGCTGTTTGTCTTTATGGAGCATTGAA
GAGATCCATTGGGATATGCATGCCTTCCATCATTAAAGTCCAACTGGAAACATTCATTCG
TGTCTCCACTTTGCCCATTCTCCCTCCATGGTTCTGTGGGGCAGGTGTTTTTCATGGAAG
CCCTGTCCCGCCCTGTCTCACTCCCCGGCACAGCGAATGTGTGACTTGGTGTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved