Loxodonta_africana Locus Mono:7:SNORD22
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:7:SNORD22
Loxodonta_africana
Mono:7:SNORD22
scaffold_5497
SNORD22
1001..1124
2124
ATAGTGCCTCCTTTAATTTTCTGTGCTTCTGCATGGCTTGTTTAGCAAAGGAAACCCTG
GCGGTGTAGCGGTTAAAAGCTACAGCTGCTAACCAAACACCTGACCATTCAAATCCACCA
GGCGCTCCTTGGAAACCCTATGGGGCAGTTCTACTCTGTTATTAAGGGTCACTATGAGTT
CGAATTGACTCAACAGCAACAGGAGGTCTGTTTAGCAAAAATACAAAATAAAATTCAAAG
GTGATCTATTTTTGTTCAATTTATAGTTTATGCAACATTTCTGATAAGTCAATACTAACA
CGCGTTATTTCTTTCAAGCTGGGAACTATTTTTCAGTCTGACTTCTCGTTTGAAATGTCT
ATGTTAACAAGGAAAGCGAGGTTAAGTGAACCATCAAGCAGGTGGTTTAGTAGACAAGAA
TAATGTTCAGAAGAGTAGAAAGTGACAAAATAAGATTTCTTCTGTTTGCTATTATTGTAA
CTACCAGTATCTCAGAAAGCTAGAATAGTTCTTCCTATTAAAAAAAAAGAAAAAGAAAAG
AGATAAATATAATAGCTTGGCGACTCTAAGCATCAAGACAATGCATTAGATGAGAATATT
AAGATTCAAAAAAGATCTTGGCAGACAGGAATGATGGGCAGAAGCTGACAAAAGGATATT
TAATAAGGATCATTTAAGTTCATAACTGAAGAACTTTTATTTGGATAAATACAAGATTTT
GTGAAAGTACTTAAGAATTTTAGAGAGAAGAAAAATCTACCATAGTTTACAGACAAAAGG
ACAGAGATCTTGGTCATTTGGGATCTAGTTGCAGATCCTTAGGTAACTGGTTATGTATCC
TTAGCAAGTCATTTTAGGGTCCCTATTTGCAGTACCAAGAAGCACTGGTGGTGCAGCAGT
TGAGCGCTCAGCTGCTAACCCAAAGGTGGCAGTTGGAACCCACCAGCCACTCCATGGGAG
AGTGATGTGGCAGACTGCTTCTGTTAACGGTTACAGCCTTGTCCCAGTGAGGAAACACTG
ACACGTCTTCCCTCCTGTCCTGGTCCCAGAGCCTGTAAAGGCGAGCCCATTGGGGCTGGC
TGGGGGGAAGAGGAGAGCTTATTCCAGAAGGAACGTCTGAGGGGTCATGGGGATTTCTGT
ACATGGGCCAGGGTGGGGTAACCACCTACTGAAAATCAGCTGTCTACTTTTTCAGGTCTG
AGGAAAAGAACAAGGCACATTTAATTGGAACCAAAGTTTTGGATGGTCTGTTGAAATTGG
CATGTATGCAGTCATTTCAGTCTGTCTGCTGTCTCTAAATAAAGCCATTTAAAAAAAATA
ATTAAAAAAACGATTACAGCCTTGGAAACCCTATGGCGCACTTCTGCTCTGTCCTACAGG
GTTGCTATCAGTTGGAATCAACTCAAAGGCAGTGGATATTTTTATTACCCTCAAAATACG
GAGGACCACTTGATTTCTAAGTTCCTTCCCTTTCACATCTAAAAATTTCTATGAGCTCAG
ATGCTGACTGACATAATGTCAGTAAAGTGATGTAGCTAAACCACTTTTTCAATTCATAAT
CACCACATAAAACTCACAGTAGTTATCTATATATGTTGTTCAGATAAGCACATACTTTAG
ACAACTTAAAAATAAGCTTTAATGCAACTGTTTTCTGGATTTTATCACATTTTCCTAGCG
ATTGTTAGATCTGATACCAGGATAAGGCAAATACAGAATTATTTATAAAACTGTCCAACA
TTTGTCTAATGACTTTTTTTGGCAAAGTGTGTTATATTTAAAAATACTATGGCAAAATAA
TTTTCATGATGGATTTTTAATGGAAATTAAGATTTTTTCTAAGGAGAATTATTTTATAAG
ATTGTTCTTAAAGTTTAAAAAAGTCATTGACTTTCATCCCTTTTTCATAAAAAATCACAG
TATTTTGATTTTTATAAGCTGTACCTATGTTTGGAGTCTATTTTACACCTCACTTTGTTT
TTAATCGAAATATAACTCATGTCCTGAAAGTTACTTCGGAGAAGAGCTACAAAAAATAAA
GCTCTGTGCAGCTTCTCATTGCAATTGTGTGTCATAGTAAAGAAAGCAAGGGTGCCATCT
GAGTCCCGGCTGCTGTTGAATGAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved