Loxodonta_africana Locus Mono:80:SNORA74
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:80:SNORA74
Loxodonta_africana
Mono:80:SNORA74
GeneScaffold_174
SNORA74
1001..1199
2199
AATACTGACTGCCTTCCATGTGCCAAGCCTTTTGGCTAGTTGGTGTCCATCAGGAAACA
GTTGGGAGGCAAAACCACCCGTACTTGTCCCCAGCAAATTCAGCGTCTGAGCAGTAAAAG
GCTTGGTAGGAATTTAGTGGTTACATTCTGAAGTCATCTAGGATCTCAGATTATCTGTGC
CATTAAGTCTGAGGAATTTTTAGGGAGAGAGGAAAGGCCTTAATTAAATGACACATACTG
CTAGAATCTGCTAGCAGTTGGACTTGGAAGCAACACTAGCGTCTTAAGACAGATTGCAAG
TTTCATCAGGGAAAGGATAATAGTGTATCTTGCCTTGATCACTGCTAGATCCCAACCACG
GTGCCTGGCACATGGCAGGAACGCCTTGAATGTTGAATGAAACACTGAAGTCATGGGAAA
GGGATTCCTCTTTTGTATTTGTTTCAAGGGTTTGGCAGCAGGGTCTGGAACCAAAGCTTC
CCTGCCCCTCCTTTTTTTTTTCTTTTTTTTAGATTGTTTTATTGTGGGAAATATATATGT
AACAAAATATTTGCCAATTCAGTGTTTTTTATGTGTATAATTTCAGTGATATTAGATAAA
TTTATATTGTGCAGCCATCACCACTATCTGTTTCCAGACTGTTTCACCACTATTAAAATA
CTCAGTGCCCCTTAAGCAATGACTTCTCCTGCTTTACACCTCTGGTAACCACTGTGGTCT
CTATACATTTGCCTATTTCATGTAAGTGGGATTATATCATATTTGTCTTTTTGTGGCCCT
GACCTTTTGCAGTAAACATTCATTTCATTTTGCTGTGTACCATCAAGTTGATTCCAACTC
ATAGCAACCCTATGTGACAAGGTAGAATTGCCCCATAGGGTTTCCGAGGCTGAAATCTTT
ACAGGAGCAGAACACTCGTTCATAGTGATGCCTTTATGCAGGTCTTCTACCTGGAGTGCC
AAGGTTCTGAAACAAGAATAGGAAAACTGTTTAAGGAATCACCCAATGGTTGTCAGCTAT
CCAGGCTAGTGTGATGCCTGGGGTGGTGTTACACTGTTGGGAGAACAAGTGCTGCCTTTG
TTGAGGTCTGGCTCCAAGCACTGTTTTGGTGTTGAGGTTAGTACCTTTCGGTAGCATTTG
CACCTCTGAGAGTGGAGTGACTCCTCCTGTGGAGTTGGTCCTAGTCTGGGTGCAAACAAT
TTTTTTTCCTTGTTAGAAAAGAGCCCTGTCTTAGGGACAGCCTGTCATTCTTTTCCTCTT
GATTACTAGGTACCTTGACGTGAATGAGAAACCTGCCTCCACCAGGACCTCAATATCTTG
ACAGCTCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved