Loxodonta_africana Locus Mono:3:SNORA72
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:3:SNORA72
Loxodonta_africana
Mono:3:SNORA72
scaffold_3781
SNORA72
1001..1132
2132
CAACAGAAAAAACAAACAAACAAACATGGGGTTAAGCAACAGGAATGCATAAAAATAAT
TTTGAAACATTGCCATACTTATTGGAGGACCTTTGAATATTTGTTTCTCTTCTTACACGC
ACGTGGCATCTCCAATTTTGTTTTTTCAAATAGAAATGAAAGGCGCATGAACATCAGCTC
ACTCTGCTGCACTAAGTTAGGCAGTTTATGCCTTCCTTGCTTAACACTGACATGTTCGTT
TAGCAAATGTCCATTAACCGAAAGGAAATTTAAAAATCATTAAATTAGACTTTTCGGTTA
GTTTGGTCCTCTACGACCACATCAAATTACTTCTGAATTAATGCTCTTAAAAAAAACAAG
TCCACCTACATTCAGAATATAGCATAAAAGCATGATAAGTTCCATGGACCTTATGCCCAA
ACTTATTAGGTATTTAAAAAACAAAAAAATCTTGAAAGGTTGAGTTAACCTAAGCAAATG
CATTGATGCCTCAATTCTCTGGTTGTTTTGACGTGTATTCCTGATGCCTCACCTGGTTTG
TAACTCTTCCATATTAACCTGCAGAGATTTTCATTCCTTATCAACCGTGCTAATGCGAGA
CTGCTCTAACGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCGTACCCTCAGC
GCCATCTCTGGTCAAAAGCTGGAACTGCAAGCCTCTGAAAAATTCTGAAGTTGTTTGGAA
GCCAGGCAGCTCTCTAATGTGGTCTGGGCTGTATTTTATTTTTCAATCTGAACATTATTT
TTGAATCTAAAGAATCTGGCCCTGGACTTGCCGCCCCACTCTCAGAGTAGCCAGTTCCAA
CAAGTGATTTTTATAACTAAAAAAAAGACAAAAACAGAAAAAACTAAAAATTCTCCGTGT
CTTGATTTCGTGATAACCAGGGCAGGAGAGACATTCACTTTATGAAGATAATGAATGTGT
CCCCAGGTCTAGTGCCTTCCCTAAGTCTGGCTTTAAAAATGCTGGTGATACACTAAGTCT
GATTTATTATATGACTATCTGGTACGGGAAACCCTGGTGGTTTATCGGTTAAGTGCCATG
GCTGCTAACCAAAATGTCAGCAGTTCGAATCCACCAGGTGCTCCTTGGAAACAATGGGGC
AGTTCTACTCTGTCCTATAGCGTTGCTCTGAGTTGGAATCAGCTTGACAGCAAAAGGATT
TTTGTTTTGTTTTGTTTCATCTGGTATGAGAAATGGCTGTAACTCTGGGTATCTTCAACC
TTAAGAGGAAAATGACAGTACAGCTAGTACAAAAGCTTTTGAAAATAACCAGTACTAATT
TGCAAAGTTATGTTTAAAGAAAGTTTAAGCAAAGAAGGAAAGTTTCAATTACTGGTTGCC
ATTAAATAAATTATAACGAACAAAGATGGAAAGTTTTAACCGAGAAGCAACTAGCTGAGC
CTACAGTGCAAGGAGCAGCCTCAAAAATTTTTTTTTTCAAAAAAAAAAAAATCTCAATAA
TTGGAAAGTTTTGCATATACTCGTTTTGCAGGGCTTCAGCAGATAGTCAGATGTGTTACA
ATGCCATACGTATTTATGCATTTTAATTCTGCCTGACATCCGTCATGTTTGCCTTTTCTC
TATTTTTCTCCCCGTTTTTCTTTAGATCCCGGTTCTCCCCCACTGCTTTTTTTTGCCTCC
TCCTGAATTGAAACTTGGTGTGGCGTAAACCACGCCTAAACATTGAAAAGATAGACTTTT
CATTTCACCATGGTTAGATCAAGCATATATCAAATTGGATGATTTGTAAATAATATTTAA
TATTTAAATAATTCTTTGTCCTTTCAATTTCAGCATATTCTTTTTACAAAAGTAGGGCAT
CATGGAATTATAAATGTTTGTGCTTGTTCTGTTTGCTATAGTTATTTCACCCTATGGTTC
TGAATACCCTACAGGGAACAAATGAAAACCATGCCTATAAAAAAGCAAAACATTAATCTC
TGATCTTGATGAACTTTGCGAGGGCACAGTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved