Loxodonta_africana Locus mono: SCARNA9
snOPY snoRNA Orthological Gene Database
Loxodonta_africana mono: SCARNA9
Loxodonta_africana
mono: SCARNA9
GeneScaffold_6514
SCARNA9
975..1300
2300
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTATGATTTTCTTTATTG
TATTTTTATATGCATTTTTCTCATCTTTGAGATTGTATGATATTTATTCTATACTATATT
CTTGCTTTTTCCATTTAAAATAATGACAAACATTTCTCATCCATTGGCTTTTTTTGGGCT
CTGAGATGTAGTATTGAAATATTTTTCAAAGAGTTTTATACATAGAATAGCAATGAAAAC
TGCAGTTTTCCAGGAAAAAGACTATGTGTTTACTGGTGAATGGTTTTAATGAATAATGAG
AAGAATTTCTTTCTTTTTTTTTTTTTTAATAAGGCGAACTTGAAGAAGCAACATTTGAAA
GTAAATTGCAGGAAAGCAGGAAATGGTGCCCTCTGGTGCTAAGAATTTAATTGTACTAAC
CCAAACTTTTTTTTTTTTTTTTTTCATTTTGAACTCTAAAATCCATTTTACAGTCAAGGC
CAAGGAGCCTATTGCGGACAGTTATGCAGCATTAAGTCATGCTGTGGAGGAACAAGGGCA
TACATATCTGGGTTCAACTGTGAAGCCAGAAAATAAGGTTAGTAATATCTTAATGTATGC
TACAATTTTTAAAGAGTTATTTGGCTTCGTATTCTCTTTTGTTTAGAGAAGTGGTAAAAA
AATTAATGTCTGCATTCTCTGAGATCCACTCTCATGAAGTGGATCAGTGATGAAAATAGC
CAAATCTGAGCATCAGAAGACCTTCTAGTCTACCTGATGCATGATCTCTATAGTTCTGGG
AAGCAATCGTATAAAATAATTTAATACAGTATGTCTGATGTGTGTGTGTGTGTCTCTGTG
TTAATAAAGGTGACAGTGGATAACTGAGAAATTGTTGATGCATGAATAGGGTTGAATGTG
TGTGTGTTTGTGTGTGAAAGGCTTATCAGTCTGAGCAATGATGAAAAAGTTTGCTACTGA
CCTTTGGAACTATGAAGGTGTCTACACTTGACCTGAGCTCAGAATTGATAATTGCTGATG
GTGATGATTTGGGGTTTCACTATTAAATTTAAGTGACATTTTTTTCCCTAGATATTACTT
CCTACATCCTGTTCTAATGTTCCCCTTGATTTTTAGGCTGAAACACAAGAGATTTCTCAT
GAGCCATTATCTTCAGTAACTATTTCTACTGGGAGCCTTCTAAGTTGTGAAAACACAGAT
TTGAGCCTTACGGATCCAGGTAATAACATTCAGAATGTTTGTAAATAAATTGAAATACCA
GCAACAATTGAGTTACGATACTGGTGAAAGGAAGTATTGCCTCTTTAAATCTCAATAGTA
AATATTGGACATTATCATATTCTAAACATGGCTGGAAGTCACAGATCCCTAACAACACTT
TGAGAAGTATTCACTCTGTCACATTTTCCCATTCAGTGGAAATCTGAGCAAATTTCTTGG
TTGCACTGATCCCATGGCATATCACCATGACTCTCTACCAAAATATGTCTTTAAGGAAGT
ACCCGGCCATGGCAATGAAATACTTCCATTCAACTCAATTTTCAGAGTCATTTGCAGAGC
AGGTGGATCATAGACAACAAGAATCTACCACTGGAAAGGAAGAGGACACAGATCTTTTAA
ATTCTGTCATTCCCTCCAATACAAGCTATTTATCAAAGGCCGAACTCTTCTGACATTCAC
AAATCTCCACTGCCTTTGATAGAAGAATTAACATCTGGTCAAACACACGTGCAGCAGATC
ATAGATAAGTACATAAATGAAGCAAATTTGATGCCTGGAAAAACAGATTTTAAGGGTAAG
TATAAAAAATGTTTTTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGGGATCTAGAGCCAACTAAACTGGCTAGAGAACACGTAGAAGAGATTAA
TTAGCAAATTTTTCGTTACCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved