Loxodonta_africana Locus Poly:0:SNORD113
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:0:SNORD113
Loxodonta_africana
Poly:0:SNORD113
scaffold_4770
SNORD113, SNORD113, SNORD113, SNORD113
1001..1075, 3754..3830, 6697..6771, 8953..9025
10025
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGGGGGTGATTTTAAAAGCAGGTAGAAGGTATTTCATTTATAGCAGAGTAGTTTAGTA
TTACTTTTTTTTAGCCTTCCCATGTGAGCAGACAAACTGGCTGATAAACAACCTTTTGTG
GCGCAGCCCATCCAATATGGAAGACGTTGCGAGTGAGAGTTTCAGAGGGGATGGGAAATG
GCCGTTTCATCATTTTTCATTAGACCATCGTTAAATAGAAATAAATAAACAGGGCCACAC
AGGGAGCAGTGCTGAGTATGGATTTGATGTGAAGCAGGAATGTTGACTGATCTATATGTA
CAATTTTCAGGGCAATTACAGAAGAAAGTCTGTTGGTTCTAAGGTGCCAGAGCCTAAAAT
TCAAGGATCTCATTTTTTGGAATTTTCTGATTGTATTATTGCATGTGAATTGGCAAATTA
ATCAATAAATGAAAAACAAAAACAAAAAACCATGCCCAGCATGGACCATTGATAAGTGTC
ATGGGGTTTCCCAAACAGGAATTTTGATTAAACCCATCTGCAACACTGAGGTCCATTACA
AAGAGACACCTTAGCTATTGTCTTTGTGGGAAATGAATCTACCACCCCTTGTTCTTGAGC
TTTTGTGATGTTGGGGTATGAATTGCATTATTATGATACTACCTGCCCATGAATAAAGAA
ATGCACCAATGAATAAAGAATGAGAGGGGTGTGCAAGCACTTAAAAAAAATATGTTGTAT
TTTGTGTTTTTGGCGAAGGTTTACACAGCATTCTAGGTTCCCATTCAACAATTTCTACAC
CAGTTGTTCAGTAACATTGGTTACATTCTTCACAATGCGTGAACATTATCGCTATTTCTG
TTCTGGTTGTTATGTTTCCATTAATCTAGTTTCCCTGCCCTTTTACATTACCGTCTTTGT
TTCAAAGTAATTGTTGGCTGATTGGTTTCATATAGGTGGTTTTTTAAAGGAGCACAGTAC
TTACAGGTGATAGGCATTACTTTTGGAACCAATTTGTTATCTAGCTACAAGGTGACCGAC
CTCAGGGGTTAGTTTTCTTCAAGGCTTGAAGAGTATCTCAGGGCAATAGTCTTGGGAGGC
CTCCAGTCTCAACTAGTCCAGTAGTTGTTTTTTTTTTTTTTTAGGAATTGGAGGTTTTGT
TCCATATTTTTTCTCCTATTCTATCAGGGTCCATCTAGTGATGCATTTATATTTCAGGCA
TGCCGTAAGACATGAATTATTATTAAGGGAATTCAAGATTCTTCTTCCCAGTAAATTAAT
ATGCAAGGCTCTTACCTCTTTGACAAGAAGCATATGGTCATTTGTACCTAAGAGTTAATG
TTTCTGTTCTGTGTTAGAGTTGAGTTGCTGATTGATCATTTTATTAAGGAAAGGAAAACA
CATTTACATAAATAAATCATTGATTGAATAACTCCGTAACTAAGAGAGAGACAAGCATGG
AGTAATAATGATACTGGTATATAGAACCACACTTATGATTAATGCAGTCTTTTTTATGGA
ATTTTACTTATGAAAATCAACATAAAAGGAGCCAGTGCGCTATTCTTTTGGGTGATGACC
TTAGGACAAATGCAAATAGTATTTGTGTTACTTATTCAGCGTCTGTGGGCTCACACATAT
TTAAGTGGAATTGTAGGTGGACAAATGCATACATTTATATCCCAGTCAAATTTTTAAAAA
GGCAGCAAACAGTCCACCACTGAGAAGTGTGTAACTGGATATAAAGATAACAGTGTTTTG
TACAACCGATACCCATAGGAAGACAACAGGTTCTAGGCCATTTTAGTTGAGCCATGTAAA
CGTTGGTGAGTAGTAGTTATTCAGTTCTGTTTTGCCATTTAAACTTTTAAATTTATTTGG
AAAAAAAAAATGAAAGGGTAGTCTTATTATTCCATGAGTCATTAAATAAATCAGTTTGTG
AGTGAAGCAATAAATAAAGTAGGATCAAACTTGGACCATTGGTGAGATTGTGCCATGAAC
TGAGTCTCTACGTATCCAATTCTGAACGATTAAAGTCCAATAAAAAAGAGGATCTTGGCT
TCTTGGCTCTTAATTAAGCGGTTAGCAAGTACAGACAAATGTTTCTAATAATTGTTGTTC
TTTTTCTTGCGCTCACTGCTAGATTCAATGGTATTTATTAAATTATTTAAAACAAAAATG
ACATAAGTCAATAAATATAAAGTAGTGCTCCCTCTTTCCCAATGTCAGGAAGATGACATG
AACCAAGGACTATGTCTAATTGATTACTGCGCTACCGCGGTTTAGTTAAAAAAGCAAATG
CAAGCGTTTGATTCTTTTTAAAAGCTGCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTACGGGGGCAGTTCTACTCTGTTACATAGGG
TCCCTATGAGTTGGCAATGGGTTTGACTTTTAGTTTTTGTCTTTGCCTTAGTTATGATGT
AAGACGGTATTCTCATGGTTGCTCATTATACCATCTTTAAAACATGGATAAGTTAAATGA
AAGCGGTCCAAGCATGGCCCAGCCACTAATATGGAGTCACCGTGACACAGCAACACTGAT
TACTTCCTGTGTGCAGCACTGAGGTGCGTAGCACAATGAGAGCTAATCCTCTAGCTCTGT
GGGAAGTGAGCTTCCACAGAGAGACTCAGATCTTCAAGGATCTTGTGATTTTTTTCTTTT
TTCCTAATTCATGAGCAATGATTATTTTATTATTAGTGATTCGATGAATAAATCAAGGAT
AGCATAATTGAATAAAGGCCTAGAACACTACATATGGATCAATGATGAGTACCTGTGGGG
CATCTGAACAAAATACTCTGATTAGACCCTGTCTGTGACTCTGAGGTCCGTTATTACTAC
AGGGACCTAGTGATGCCATCCATGGGAAATATACTTGGAGAGGAAGTTAGAAACATCCAG
GGGTCATGTTTTTGTCTTTCGTTGTTCATGAATGTGGATTGTATTACCATGCATAAAAGA
ATGCACGAATAAGTAAATAAAAGTATAAATAGATAAAGACAAAGAGGGACATAGCTCATC
TAATTATTACAGAAGCTAATAAATCAAGGATTATTATGAATACATCTCTAAAGTTTTGAG
TTCAGATAAAAGAAATGGAATAGGGTCATTCTCCCTTTGGGAAAGGAGCATATGCGTGGA
TATATATGGGCATCATTGTTGTTCCAGGTTGGTGGTGAGTTACTGGTTGCTTGTTTCATT
TTAAAAAGGGACAGTATGTTTACATAACTAAATGATGCATTTAATATGATAATATTTGGT
GTAAGCAATAATAAGAATATAGTCAATGATGACTCAATATAGTAAGTTTAAATTGTTATA
GCATAATAATTTAATATCATTAATAATAAAATTAATAATGATTAGATAGTTATTGGAAAA
CCTGGAAAAGGCCTGAGCCTGGACAAACATTGAGGCTGTGAACGTAATAAACGCGAATTC
TCTTGTGCCCCTGACTTAGAAATAGAAAAATATGAAAGCCTATTGTTGTTGATTTCTGAG
TAATAAGCGAATGGATGGGTGCTAGTGTTTCTTAGGGTTCTTGCTCAATGTCCTCAGGGC
TCACAAATGTTGGTGCTATTATTATATGTGAGCAAAAGAAGAATTTCATAATTTAATCCC
ATATTTAAAAAAGGAAACCATGGCATGGATCCTTTTGAAGCTGATTTAAACCAATAAAGC
CCCAGGACCCGCACCTTCTTTAGGTAAGGGTCATATAGACCTCACTCCCTTGCCACATCT
AGCTATTCACGTTAAAATTAAAACAAGTTAAAAATAAAAACCCAGTTCTCCATTCACACT
AGCCACATTTCAAGTCATCATGTGGCCAGTGGCTACCCTGCTGGGCAGTGCCAATAGAGA
ACGTTTGCATCTTGGCCTGAAGTTCTGTCATCGCGGAAAGTGCTGATGGAGACAGTCGAA
GGCAGTAGTGTTCAGTGTGGGTAGTAGGTGGTTTTGCCACTTTGTGTTTTTCTTATTGAG
AAAGAACAGATGATTAAATGATTCTAAGGGTCATAAAAGGAGCCCTGGTGGTGCAACATT
TAAGCGTTCAGCTGATAATCGAAACGGTGGTGGTTTGAACCGACCTAGCGGCTCTGTGGA
AGAAGGACCTGGCTTCCGTAAAGATTATAGCTTAGGAAACCCTATGGAGAAGTTCTCCTC
AGCCACATGGGGTCTCTATGCATCGGAACTGACTTGACGGCACCGAGCAACAGCAACAAG
GGCCATAAAGTCAATTTGTTTGGATTGTGTCATGAAACAGGGATTTAAACTCATCCCATT
TTGCAAAACTTTTGTTCATTAAAAAATATAGACAGATACCAGCAGTAGTTATAGTTAGTC
ATCTTGTGTTGGGTGGTAGGTTAAAAGCCGTTCAAGTTAGTACATGAAAAGGATGCCATC
CATGGGCTGAGGGTGAGTCTGTGACACAGACCCAGTGCTCATGACTATAATGTAGTAAAG
CAGAACTAAATTCGTTTTTTAGCTCTGTTCGTTCTTTTTAAAACTCTACTTTTTCTTGCA
GAATGAACACTACTGTGATTCCACCATTCTCCAGTGATGAATGTCTCAGGTGCTACTTCC
ATGGATAAGGAGCACAGATCACCAATGTCAGTAACGATCAAAGCTTTTCTTCTTGGTTTG
GGTGCATGTTCATGTGTGGTCACTGATGTACAGTCGAGTCTTGTTAGTCACGGTGGTTAG
GCTCTATAAAGTCCCCGTGAACGCTGAGTGAAGGAATATCAAACCAGCCTTGTTTGTACT
CAGCTGGGACCTTGCACCTTGGGCAGCTCCAATTTTTCAGCACTTTGCACATGTTCATGT
TCATGTTCATGAATGACTGCTAAAGCTCAGCAGGTATTGATTTTGGGATTAGAAATATGT
TTTAGCCCGTAAGCAAATTTGTGCATTACAGAATCTGTGAGTAATGAGGATCAACTCTAT
TTCAATGGAAGAAAAGACCATATGCACATAAATAAAATTCAGGAGCACCAAGTATGGGGC
AATAGTTGGTACTGTATCACGTGGACCAGGGAGTAGGGCTAACTCATTTCAGCACAACTG
AGATCCATTAAAAAAGAAAAAAAAAGATGGACGGCACTTAATTCATTTTTGGAATTTGAT
ATTCCATACAACGTTTGGGCTACAGTTGATTTCAATATTCCCATAATGGTTAGAGATCCA
GGCCGTTAGCTGTTTAGGGAAGCTCTCAGAAGGTGGAGCATACTGTATGTGTTCTAGTTG
TTGGATGTCATTGTGGTGTTTTGTTGTTCATGATGCCATGTTTAAAATTGGATCAGTTAA
ATGGCAGTAGCCCAATCATGTAGCCTTGGTGGCACAGTGGTTAAGAGCTTGGCTTCTAAC
AAAAAAGTCAGCAGTTCGAATCCACCAGCTGCTCCTTGAAAACCCTGTGGGGCAGTTCTA
CTCTGTCCTATAGTGTCGCTATGAGTCAGAAGTGACTCGACGGCAATGAGTTTTGTTTTT
TGGGTTTAGCTCAGTCATGGATTATTAATGATGATGACACTGGTACAAGGGGAGTTTTGT
TGATGATTCCGTATGTATAACACTGAGGTCTAGCTTCAAAGCTCTGTGGGAAATGAGTCT
ATAGGTAGACATAGTCATGTCAAGGATCTTGTTGTCAGGAGTTTGTGAGTCATAGAATGG
GAAGGTATACATGAATGAAGAAAAGGAGTGCCACGTGTAGACCATTGGTGAGATTGGGGG
ATGTCTGAATCAAGAATTTTGATTAAACCCTATCTGCAACCCTGAGGTCCTTTATAAACA
GAGACCTGCTTTTTTCCTTCTATGGAAATGGGATTATAGCAGAAGTTGAAAATATTCATG
TATCTCAATCATAGGCATTCAGAGTTTATGATTATAGCCTGAGTTTTTAGATGGGAACCA
ATGTACTAATAAATAAAGAAATGTATGAATAAGTGAGTATAAAGAGGGATGGTTATGGGC
CAATTATGGGAGTAAATAATAAGACATGGATTGTTATTAACACATTTTTGTAGCACTGAG
TTAGAGTAAAATATATTGATAAAGGCTATTAACTCTGGAAGGAGCTTGTGGACAGATGCG
TGTAAGACTCAAATTATTATTTGAAGTTGGTGGTTGTTTGTTTTTATATAGAGAAGGAAG
ATATTTACATAAATAAATGATAAATTAGTTATTTAATGGGAAGAAAGAATAAGCTTTGTT
CATCTTGAGGAGTGCCTTACGAAAAGAGTTATTATTAACCCAACTCTTCATTGAGTTTTA
TTAAAAACAAGCAAAGGGATCTAGTTTTTTAAATCTCTTTGGTTAACGTAACAGACGTAT
GGAAGCATAGCAACATTATTCAAGATTCTTGTCCGGTGTTAATTTCCAGCTATTGATGAA
TTGTTACATGTGAATGAATGAGTAAATTCTTACAGTGGTCAATTTTTTATAAAAAGAGAG
AAAAGCATGCTCTAATGAAAAGGACGTGTTTTGAAGCAAGAATTGTGAGTAACCTTTGTC
TATACTAATGACTCTCTCTTCCCAGTATAGGTACAGGCATATAGACACTTGCATGCAGAG
GGCATCTCCATTCTGGGTTGTTTACGAGTTTACCATTGCGTGTGCCATTTTGTGTGTGTG
TGTCTGTGTACTTTTTTCTTAGGATATGTGACTATCTGATTAAATTAGTCCATAAGTTAT
CCCATAAATGAATAATAAAGCAATGTGCAATTAAATTAATAGATAGGTAGATCAAGCTTA
AACTTTTTGTAAGAATATGCCATGAGTCATGAATTTAAATTTATCCATTTCTACACAAGT
TGAGTCCATTAAAAAAATTATTTAGCCTCTTGCCTATGTAGATAGGAGTCTATAGACAGA
TGCTTGTGCTAGTCATAGCTGTTTTTGAATGGGGGATGCAAGGTGTTGATTATATAATTT
AAATTAATAATTAAATAAGTCAAGGAGTAAAAAGGTGTGCTGTTCTTGGGTCAAGATGAA
TATGGTAAGTGAATCAATTTTCTGATTAATCTGGAACCACACAAATAATGTACTTAAAAT
GAATCTAAATCTAGGCTGTTCATTCTTTTGAAAACTGGCATTTGACTCCACAGAGTGAAG
ACCATGACTGATTTAATGAATTTCTACTGATATAGATCTTGGCTATTCTCTTCGTGAGTA
AGGAGCCTAAAGAATGAAGTAAGTAATGCTGAAAAGTTCTCCGTTTGGGTGAATTTTTAT
TAGTGTTCACTGAATTATTAAATTAAGCCCTGTATAGACCAATGATAGGAATGTGTTATT
AGAATTCAGCATAACTGTGGTTAAAAATAAGATGGAGAGCATTTTGTTCATTTTGGAAGC
TGATGAATTATCCATCTAATTTTTATACTGCATTTGATCTAAACATTTCTCCAGTAATAA
AATCTAGCAATACACTGTCCAGTGATGTCACTGCTAGCCGTATATGGCTATTTAAATTGA
ATTTAAGTAAAATTTTAACGTTCAGTTCCTCAGTTGCACTTGCTGTCTTTCAAGCGCTAA
GTAGCAGCATGCGGCTAACGGCAATCATATTGGACAGTGAAGTTATAGGACATTTTCATC
ATCACAGGAAGTTTTATTGGACTGTTCCTTGCTGAGGGATGAGCATATAGGAAGATAGTT
GTTAATGAATCTATTGGGTGTATAGTTGCTTATTTTACCATCTTTATAATATGAACAAGC
TAAATAAAAGAGGAATAAGGTTGGGCCAGCGATGACTATGGGAAGAGTATGAAGCAAGGA
TGTTGATTGATCCATTGCAAAACGAGATTTAGTCTACTAGCTCTACGAGAAAATAGCTTA
TAAACAGATCCTGGCCTTATTCAATCATCTTGTTCTTTTTTTTAAATTCACGAGTGTTGA
TTTTATTACTGTTAATGACCCTGTGAATGAATCAATAAAGAAAGGTATAAATGAAGAAAA
GAATTGCTTAGCCCGGACCAATGATGAGTACCCTGGTGGTGTCTGAATCAAGGATTTTGA
TTATACCCTATAACTCTGAGGTCTTATTTATTTTATCAATGAAAAATGAATGTATTCCAA
GAGTTAAAAATATTTGGGAGTGTGTTCGTGGTCTTCTGTGGCTCTTGAGTGTGGATTTTA
TTATTTTTAATTAATCAGTACAAAACTACATAAAGAAATATATAAATGAATAAAGGCAAA
ATGGGCTATTCCTTGTCCAAATACGAGAGTATGTAATGCAATGAGAATCACTACTAATAT
ATTTTTGAAGCTCTGAGCTCCAATGAAGGAAATTAATCATTTTGAGTAAGGAGCATTTAG
ATTGATGGATTTTAGAGTTTGTGTTGTTGTTCTGGGTTGGTAGTTGTGTTTTTGTTTCAT
TAAGAAAAGGGTGAAACTTTTCCTTAAATTACTTATTAATTAAATAACTTCCTAATTGAG
GGAGGACCTACAAGTATATATCTCTGTCGAGAATATGTCACATGACCAATTATAATTAAT
CCAGTGATCTTCAGTAAGTTCTAATTAAAAAAAGAAAAAAATGACCTGATCTTTTTTCTG
TGCCTAATGAGCATACGGACACATATGTTCATAGTGTCCAGTTTCTGTAGGAACACAGAT
ATTAATGGTAGTGTATGAATGTATAAAAGAATCAGCTCATATCTCCATCAACTATTTAAA
AGAATGCAACCCATGGAGTGATGAGGCGCATTTGATATGGAATAAGGACCGTGATTAATC
CAGTTCTACCCAACCGCTCTTCAAATAAAGAACACAAATCCAGGTTCTTACCACTTTTTG
GAATGGCAAATATATTTAGATTGGATTTCCCTTTCTTGTTCTTTTGGTGCATTTACCATT
GACAGTTTCCTTAAAAATATAATAAATACTTAAATTACTCTATGTGTAACTACATACATA
CATATAAGTAAGAACATACATAAGTCAAAAACTTGTGGCCATCGAATCAATTTCGACTCA
TAGCGACTCTACAGGACAGAGCAGAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved