Loxodonta_africana Locus Poly:5:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:5:SNORD115
Loxodonta_africana
Poly:5:SNORD115
scaffold_588
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2712..2792, 4410..4487, 6105..6185, 7804..7881, 9500..9580, 11207..11288, 12913..12993, 14613..14690, 16311..16391, 18010..18087, 19706..19786, 21405..21482, 23106..23186, 24808..24886, 26508..26588, 28208..28285, 29906..29986, 31605..31682, 33302..33382, 35001..35078, 36701..36781, 38410..38487, 40106..40186, 41805..41882, 43501..43581, 45203..45280, 46904..46984, 48603..48680, 50299..50379, 51998..52075, 53694..53774, 55393..55470, 57091..57171, 58790..58867, 60486..60566, 62185..62262, 63881..63961, 65582..65659, 67294..67374, 69028..69105, 71634..71714, 73345..73422, 75044..75124, 76728..76805, 78424..78504, 80160..80237, 81879..81959, 84038..84115, 85742..85822, 86303..86380, 88002..88082, 89707..89784, 91402..91482, 93101..93178, 94797..94877, 96498..96575, 98194..98274, 99893..99970, 101589..101671, 103292..103370, 104984..105064, 106681..106758, 108377..108457, 110085..110162, 111781..111861, 113480..113557, 115175..115255, 116874..116951, 118616..118696, 120316..120393
121101
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATT
GCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAG
TTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGGCCGATTTTGGTCAGGCTGA
TTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCAC
CGTTGCGAGGACAAAAGGTGAGGGATTTTCCCGTGATTTGCCCTGGTCCCCATCTGACAC
TTAGGCAAGTGAGGATACACTCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCAT
GTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGC
GTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTGTTTT
CCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCT
GTATTTGAACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCC
ATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAAGT
GAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTG
AAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCT
GGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTG
TTCCTACCAGATTGGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCCTCTCTT
TGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCA
TTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAAC
TCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGT
CCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGT
GCTCGTGCACGGAACAGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGG
GGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCG
GAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAG
TCTCACTAATGGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGGCTATATGT
GGAAAAAAGCGTAGCTGGTTAGGCAATGAATGTCTCTCCGTCTGATGTCTGGACTTACTT
CTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTC
AAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCG
GGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGA
TTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATA
AAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATG
AATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAA
AAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTG
TCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAAT
GACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGG
CAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGAT
TGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAA
TTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTG
AGAATATTTTCAACTCTCAACTCTTTACGGGCTGGGAGTGTGTAGCAGCTCTACTGGAGA
AACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATC
TCCAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCT
CGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAG
GTTCAATCCCATTCGGTAAGTGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACA
GGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCAC
ATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTC
CTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCC
TCTCTGGGGATTATTGCGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGT
GAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAA
GCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTT
GCGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATACTTGGCA
GCCTTCAACACATCAGTCAGGCTTAATCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCC
TGAAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTC
TCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGT
CCATGTGTTTGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAGTGAGTTTCTCTTCTG
GGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTGTCTTGTC
CTGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTC
TCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCA
GGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAG
AGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTC
CTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCT
GCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCT
TTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGAC
AAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGG
ATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTG
CTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCA
GAGAATGCTGAAACCTGTTGCTGGAGTCGTCTGCGATAGCCTGCGTCCAAGTCCGATACG
GCCTACTGAAATGGGAGAAACGGCCAACTAGAAAAACGTGTTTTCCTGAGACATTTATGA
GATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTATTTGAACGCGTGT
GTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCCATGAATCTTGAAACTG
GATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAG
ATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGAGGGT
CAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGACAGTG
AAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATCACTGCTCCTACAGAGTTGGT
TGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGAT
GGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCC
TGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAAT
TTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATC
CCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCC
TGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCT
GTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTT
GATCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGT
GTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCA
ATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAG
GTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAG
GATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAG
GAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACA
CCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAGGATCCCGCTG
AGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGTGGACCCCCG
TTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCA
TGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTAGAGTGACCTGCTTTCAGGAG
ATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTG
ATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGA
CGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGG
TGCATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTC
CGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTA
CGGGCTGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAA
GCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCG
GTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCA
GCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCG
CGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTA
ATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAG
ATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCT
CTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGG
TAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGG
CAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAG
CTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCTGCAC
ACATTGGACAGTGCCCGTGGACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAA
TCAATTGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGAC
CTCTATGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTC
CCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGA
AAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGGGATCTCTGTCTTACCCACTTCCCCT
TTTCAAAGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACT
GCCCGGGAAACTGGAAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAA
GGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATG
GCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCT
CAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCT
TTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGG
TGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCAC
AACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTT
GCCCTGGCCCCATCTGACACTTAGGAAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTT
GCTGACAAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTG
GCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATATGCGCTGGA
GTCGTCTGCGATAGCCTGGGTCCAAGTCCGATACGGCCTACCGAAATGGGAGAAACGGCC
AACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACA
GGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGA
TTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAG
CTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTC
AGGGTCGAGGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCA
CAGGAGGTCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGC
ACATGTGCAAAGATCACTGCTCCTACAGAGTTGCTTGGAATCCTGTAGATGTTCCATAAG
ACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTAT
TCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAA
GGGTGAAATCAAACTCGGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGC
CCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGT
CATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCG
TAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTA
TTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTG
TCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTT
GGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTG
ACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCA
TGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCG
TGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTT
CCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATG
ATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCA
CTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAA
GTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTC
TTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGT
GTTTTCGAGAGTGAGCGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAG
GGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCT
TGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAG
GGACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGT
CTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGCTGGGAGTGTGTAGCA
GCTCTACTGGAGAAACCAGAGAGACTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGG
ACTCTTAGGATCTTCTAGGGCATCTTTCTCAGACATCTCGGTATTGGATGAAGAATTGAG
TAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAA
AAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTC
AGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAA
CTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAG
ATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGA
GGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTC
CATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGC
AGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGG
TGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGG
ACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTTT
TGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAAT
ATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGC
TGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAAT
GAGTTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGT
CGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATG
ATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTTGTGGTAAG
CATCTTCAGGTCTCAGGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGGTCAATGATGA
CATAATCTGTTCTGGAAGAGAGATGATGACCTTAAAAATCATGCTCAGAGGAGGTTATGC
TGGATGCCCTGTGGGGAAAGTCCTTTGGCCCAGCCTTTCAGATCTTCTTTTATAGCGGGA
CTCCCATTTTGATTTTCTTTCACCTGCACTAAATAAATCCAAAAGAACTTGGGTGGGCCA
ATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTG
CCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTG
GCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGAC
AAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTG
ATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTTGCTGGAGTCATCT
TCGATAGCCTGCGTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGA
AAAACGTGTTTTCCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACT
GGTCAACTTGCTGTATTTGAAATCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAG
GGCGCATTTCCCATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTC
CAGCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCG
ATGCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAG
TCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTG
CAAAGATCGCTGCTCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTG
CTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGT
GTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAA
ATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTC
CGAGTGTCCCACAGCTCATTTGAAGATCCTCAGTTTTGGGAACCCTTGGATGTCATTTCC
TGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACAT
TAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCT
CCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAAGGG
TCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTA
TATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACT
TCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGT
CAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGC
GGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGG
ATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACAT
AAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACAT
GAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCA
AAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCT
GTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAA
TGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAG
GCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGA
TTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGAGCAAGCACAGGAACCTAGAA
GAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGT
TTGAGAATATTTTCAACTCTCAACTCTTCACGGGATGGGAGTGTGTAGCAGCTCTACTGG
AGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGG
ATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATA
CCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGG
CAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGC
CACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTT
CCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGA
ACTCCTTTTCCGTGTGCCCCACAGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGA
TCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAG
TGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTG
GAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCAGTGCTGGGGAC
TCTTGCGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACACATATTT
GGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTTTTGCCTGGGTC
CTCCTGAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAATATTGCGTGATT
CTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTT
TGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCCT
CTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTGTCTT
GTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACG
CTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTC
TCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGG
AAGAGAGATGATGACCTAAAAATCATGCTCGGAGAGGTTATGCTGAGGCCCCGTGGGAAA
GTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCA
CCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGC
TCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAG
GACAAAAGGTGAGGGATTCCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTG
AGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTCCCCTGGTGT
TTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAA
TCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGCGTCCAAGTCCGA
TACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTGTTTTCCTGAGACATTT
ATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTATTTGAACGC
GTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCCATGAATCTTGAA
ACTGGATGAGCGACTCAGTAGTCCGAAAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGC
ACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGA
GGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGAC
AGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGTCAAAGATCACTGCTCCTACAGAG
TTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCT
CTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGG
TGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGT
TGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGA
AGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACA
GTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAAT
AGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTT
GTCTTGATCTGGCACGTGTCTGCCTGTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGA
GAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTT
AGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATT
GCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGG
AAGAGGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGT
GGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATG
AAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATC
CCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGA
CCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTT
TGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTT
CAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCT
CTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAG
CTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATG
CACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTG
CTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAAC
TCTTTACGGGCTGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAG
TTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGAC
ATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAG
GCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGT
GGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACCGGAGGTCATGATCCGCTGAG
AGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCT
TGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACAG
GATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGC
CTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCTTTGAAGGA
CTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTC
CTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGT
CTGCACACATTGGACAGTGCCCGTGGACACATATTTGGCAGCCTTCAACACATCAGTCAG
GCTTAATCAATTGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGCGCTACATCC
AGAGACCTCTATGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGC
AGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTTGCGAATGTCT
GGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCCTCTGGGATCTCTGTCTTACCCACT
TCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAG
CCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGG
GTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGT
GATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAAT
CATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGA
TCTTCTTTAGAGCGGACTCCCATTTTGATTTCCTTCACCTGCACCAAGTAATCCAAAAGA
CCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTT
TAGCACAATCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCG
TGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTA
GGGTTTGCTGACAAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGAC
TAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTGT
GCTGGAGTCATCTTCGATAGCCTGCGTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAA
TCGGCCAACTAGAAAAATGTGTTTTCCTGAGACATTTATGAGATGTGAATGGCTCAGAGC
TCTACAGGAGACTGGTCAACTTGCTGTATTTGAACGCGTGTGTCAGTTGCGGTTGGACTC
GTAGGATTTGCAGGGCGCATTTCCCATGAATCTTGAAACTGGATGAGCGACTCAGTAGTC
CGAAAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCT
AAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTC
ATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGGCGTAAGTGCTG
CCTTGCACATGTGCAAAGATCACTGCTCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTC
CATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAG
ATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATG
GCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGT
GAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTT
GGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAGATTTGGCT
TCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCC
TGAGTATTTTTCTCCATTCGGAGTCCTCTATGTCTTGTCTTGATCTGGCACGTGTCTGCC
TTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCC
ATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGA
TGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTG
CTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCAT
CCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTG
ATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGA
GAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCC
TTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTC
CACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTT
TTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACT
CAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAA
GGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGC
TTGACCTGACCGATTGACCAAGTGGCGGTGATAGGCACGGGTGGATAGTTAGGAAGCACA
GGGACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATG
TCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGC
AGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACT
GGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGA
GTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAA
AAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTT
CAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATA
ACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGA
GATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGG
AGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCT
CCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGG
CAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCG
GTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTG
GACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTT
TTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAA
TATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGG
CTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAA
TGAGTTTCTCTTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGG
TCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGAT
GATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAG
CATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACA
TAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGG
CCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTT
TGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTAGGGTAGGCCGATTTTGGTCAG
GCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAG
TTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGA
CACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGC
ATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGG
TGGATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCT
GCGTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTGTT
TTCCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTG
CTGTATTTGAACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTC
CCATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAA
GTGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTG
TGAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCCACTTAGGAAGTCATGTT
TCCCTGGAGCTCTGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAACAT
CACTGCTCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTT
TGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCA
TTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAAC
TCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGT
CCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGT
GCTCGTGCACGGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGG
GGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCG
GAGTCCTCTATGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAG
TCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGG
AAAAAGCGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGC
CCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTA
CTCCCCGGGAAACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGG
ATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGA
TGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATC
ATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGAT
CTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTC
CTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTT
AGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGAC
GGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCG
GGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCA
AGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGGACCTAGAAGAATTTCCA
CTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATA
TTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAG
AGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGG
GCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGT
AGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAA
TCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGG
TCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTG
GAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTT
CCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCT
GGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAAT
GAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTAT
TCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTG
CCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTT
CAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAA
ATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTG
CTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATG
TGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATC
TCTGTCTTACTGACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCTGCT
TTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATC
CACTGTCCTTCCTGGGTAGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGAGG
GATTTTTCCTGGGGAGTGATATGAGCTGGGGTCAATGATGACATAATCTGTCTGAGAAGA
GAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTAGGGAAAGTC
CTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCT
GCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCC
TTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGAC
AAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGG
ATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTG
CTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCA
GAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAG
GGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTAGTTTTCCCAAGATATTTAT
GAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGT
GTGTCAGTTGCGACTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAAT
TGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCAC
AGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGG
GTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAG
TGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTC
GTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTG
ATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGG
CCTGGACTGTGTCTCCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTG
AATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAG
ATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGT
GCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAG
CCCGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGT
CTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGA
AGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAG
GCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGC
AAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAA
GAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGT
GAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAG
ACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCG
CTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCC
CCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGG
CCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAA
GAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTG
GTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTG
AGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCAC
GGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATA
GTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCT
TTACGGGCTGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTG
AAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATC
TCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCA
GCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGG
TCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACCGGAGGTCATGATCCGCTGAGAGT
CTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGA
CAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGAT
CCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTG
AGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTG
TGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTC
CAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGCTTGCCATTTCCCGGGAGTCCG
CACACATTGGACAGTGCCCGTGGACACATATTTGGCAGCCTTCGACACATCAGTCAGGCT
TAATCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCATA
GACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAACATA
CTCCCCAGTGGGTTGCAGATGGCTGTCTTGATTTTGTCCATGTGTTTGCGAATGTCTGGC
TGAAAGCCTACTGTTATGGAAATGAGTTTCTCTTCTGGGATCTCTGTCTTACCCACTTCC
TCTTTTCAAAGGGTTATGTGAGGTCGATGTGTCTTGTCCTGCTTTCCTGGGGGTCAAGCC
AACTGCCCGGGAAACAGGAACATGATGTGTGAACTCTCTCATCCACTGTCCTTCCTGGGT
GGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGA
TATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCA
TGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATC
TTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACC
TGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTA
GCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTG
ATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGG
GTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTA
AGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGC
TGCAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAAC
GGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTC
TACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGC
AGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTG
ATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAA
AGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGAT
GCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCC
TTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCA
TAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGAT
GTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGC
ACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGA
AAGCCCCTTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTT
GGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCT
TCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCC
TGAGTACGTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGTGTCTGCC
TTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGATTTTGTCC
ATACTTGGGGCTATATGTGGAAAAAACGTAGCTGTTAGGCAATGAATGTCTCTCGTCTGA
TGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTG
CTTTCATGAGGGTCAAGCTACTCCCTGGGAAACCGGAAGAGGATGTGGGAACCTTCTCAT
CCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTG
ATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGA
GAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCC
TTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCTTTTTCCTC
CACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCTTGGCTCTT
TTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGATTCACCACCGAAAGAACT
CAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAA
GGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGC
TTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACA
GGGACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATG
TCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGC
AGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACT
GGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGAAGAATTGA
GTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAA
AAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTT
CAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATA
ACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGA
GATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGG
AGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCT
CCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGG
CAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCG
GTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTG
GACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTT
TTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAA
TATTGCGTGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGG
CTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAA
TGAGTTTCTCTTCTGGGACCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGG
TCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGAT
GATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAG
CATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACA
TAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGG
CCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTT
TGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGC
TGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTT
CACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACA
CTTAGGCAAGTGAGGATACACCTCAGAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCAT
GTTCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGG
GTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTT
CCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCT
GTAATTGAAAGCGTGTGTCAGTTGAGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCC
GTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGT
AAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGGTCGATGCCAGGTGT
GAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCC
TGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGT
GTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTG
CCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCT
TTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTG
GAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCA
CAGCTCATTTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTC
GTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCT
GATCAAATGAATAGCCTGTTCTTGGCTGGGACTGCCCGAGTACTTTTCTCCATTCGGAGT
CCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTC
ACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAA
AGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTT
CCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCC
CCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGG
ACGATATCGGTGGTGAGGAACTTGCAGACTCAGGTGATTTCTCCCGGAGATTGAGATGTC
TCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGATAGATGATGACATAAAAATCATGC
TCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGC
TTTAGAGGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCC
CTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAG
AGACCTGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTT
TTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTT
TTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTG
GCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTG
AGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTT
CAACTCTCAACTCTTTACGGGCTGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAG
ACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCAT
CTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCA
TTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCC
ATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCAT
GATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAA
GATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGT
GTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGG
ATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAA
GCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTT
TTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGCGTGCCAT
TTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACACATATTTGGCAGCCTTCAAC
ACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTT
GTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGT
CATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTT
CGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGGGACCTCTG
TCTTACCCACTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCA
CGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACT
GTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTT
TCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGAT
GACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCC
AGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGT
AATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTT
TTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGA
GGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCTC
AAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTT
GCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCT
GAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGCGTCCAAGTCCGATACGGCCTACTG
AAAGGGGAGAATCGGCCAACTAGAAAAATGTGTTTTCCTGAGACATTTATGAGATGTGAA
TGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTATTTGAACGCGTGTGTCAGTTG
CGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCCATGAATCTTGAAACTGGATGAGCG
ACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATAAGTGC
ATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCACACGAGGGTCAGGAGCA
CTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCTGGACAGTGAAAGCAGG
CGTAAGTGCTGCCTTGCACATGTGCAAAGATCACTGCTCCTACCAGATTGGTTGGTTGGA
ATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTT
GATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGA
CTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGG
GGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCA
GTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTG
GACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTC
TTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATC
TGGCAGGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGT
GTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGA
ATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCG
AAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGACG
TGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAAC
TTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGC
CCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTG
GATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCT
GATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTC
ACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACAC
TTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTG
TCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGA
TAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGT
TCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGG
ATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCT
GTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTAT
TGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCAC
CACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACATGGGTCGCGAG
CGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCA
GGGCAATGCAGGCATAACTGCTGCCCTTCCACATGTGGAAAAGATCATTTTCTTGGAACA
GATCTTTGGAATCTTGTAGAGGATTTCCATAGAACTCCTTTTTTCCGTGTGCCCCACCGG
GGATCCTCTGATGCTTGATATACGGGAGGAGAAGTGTTCCCTCTCTGGGGATTATTGGGG
CCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGG
ACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGT
CCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAG
TCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCA
GGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTACATC
CAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAG
CAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTC
TGGCTGAAAGCCTAGCCCTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGAT
TTCCCCTTTTCAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAG
CCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGG
GTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGT
GATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAAT
CATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGA
TCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGA
CCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTT
TAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCG
TGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTA
GGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGAC
TAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAACATGTGC
GCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAA
ACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGC
TCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTC
GCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTC
TGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCT
AAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTG
ATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTG
CCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTC
CATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAG
ATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATG
GCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGT
GAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTT
GGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCT
TCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCC
TGAGTACGTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCC
TTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCC
CTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGA
TGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTG
CTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCAT
CCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTG
ATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGA
GAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCC
TTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTT
CACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTT
TTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACT
CAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAA
TGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGC
TTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACA
GGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATG
TCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGC
AGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACT
GGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGA
GTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAA
AAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTT
CAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATA
ACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGA
GATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGG
AGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCT
CCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGG
CAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCG
GTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTG
GACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTT
TTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAA
TATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGG
CTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAG
TGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGG
TCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGAT
GATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAG
CATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGCTGACA
TAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGG
CCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTT
TGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGC
TGATTCCTTGGCTCTTTTCCTCCTTTTGTGTCCTTTAGCAAAACCTGCCTGCAAGCAGTT
CACCGTTCCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACA
CTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCAT
GTTCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGG
GTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTT
CCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCT
GTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCC
GTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGT
AAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTG
AAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCT
GGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTG
TTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGC
CAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTT
TGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGG
AAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCAC
AGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCG
TGCACGGATCTGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTG
ATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTC
CTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCA
CTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAA
GCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTC
CTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCC
CGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGA
CGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCT
CGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCT
CAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCT
TTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCC
TGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAA
GACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTT
TCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTT
TGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGG
CGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGA
GTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTC
AACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGA
CTTGCCCTAGTTGAAAGCCTGTGTCAGTTGGGACTGGACTCTTAGGATCTCCAGGGCCTC
TTTCCCAGTCATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCAT
TCAAAGAAATAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATAC
CATTTCGGTTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGT
CAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGG
AAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTC
CGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTG
GGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATG
AAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTGGAAAGCTATTC
TTTTCCAAATGTCCTTCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCC
ATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCA
ACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAAT
TTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCT
GTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTG
TTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTC
TGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTT
CATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCA
CTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATT
TTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATG
ATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTTGGTGGGAAAGTCCTTTG
GCCCAGCCTTCCAGATCTTCTTTAGAGCGGGACTCCCCAATTTTGATTTCTTTCACCTGC
ACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTT
TCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAA
AAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGAT
ACTCCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCT
TGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGA
GAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGG
CCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAG
ATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTG
TCAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGG
ATGAGCGACTCAGTAGTCTGATAGTTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGA
TAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTC
AGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGA
AAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTT
GGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATG
GTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCT
GGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATT
TGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCC
CCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCT
GTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTG
TTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTG
ATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTG
TGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAA
TGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGG
TCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGG
ATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGG
AACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACAC
CTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGA
GGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGCTCTGCTTTAGAGGGGACCCCCAT
TTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTCTGGTCAT
GCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGA
TTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGA
CACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGAC
GTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGT
GGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCC
GGTTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTAC
GGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAG
CCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGG
TATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAG
CACCACTATCTGAGTCAAAAAACTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGC
GAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAA
TCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGA
TCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTC
TGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGT
AGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGC
AATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGC
TGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACA
CATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAG
CAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACC
TCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCC
CCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAA
AGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTT
TTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTG
CCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAG
GAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGG
CTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTC
AGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTT
TAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGT
GGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACA
ACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTG
CCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGCTTTG
CTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGG
CGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAG
TCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCA
ACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAG
GAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGAT
TTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGC
TGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCA
GGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCAC
AGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCA
CATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGA
CTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTT
CCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAG
GGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCC
CTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTC
ATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGT
AGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTAC
TTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGT
CAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTT
GGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGA
CTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCAT
GAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGT
GATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTC
CCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGA
TGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCC
TAACGTTAATGATCTGCTTTAGAGGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAG
TGATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCT
TTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTG
AGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCC
CAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCT
GACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCT
AGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGG
AAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTA
CTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCT
TAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCT
GACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTA
ATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTC
ATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTG
CCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCA
TAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGAT
GTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGC
TCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATT
CTTGGAATGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATTCCCTGGTGCTGG
GGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCAT
AGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTG
GGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCA
TGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTT
GATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTT
CTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGT
CTCTTGTGCCGCTTTCATGGGGGTCAAGGCAACTGCCCGGGAAACTGGAAGATGATGTGT
GAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTC
AGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTG
TCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTG
GGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTC
TTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCC
TTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTT
GCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGC
AAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCT
GGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTT
AGGAATCAGAGAATGCTGAAACATGTGCGCTGCAGTCGTCTGCGATAGCCTGGGTCCAAG
TCCGATAGGGCCTACCAAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGA
TATTTAGGAGATGTGAATGGCCCAGAGCTCTATAGGAGACTGGTCAACTTGCTGTAATTG
AAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATC
TTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTA
GCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGA
CACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTC
TAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTAC
AGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAA
TCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAAT
GAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCC
TAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCAT
TTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGG
ATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAAT
GAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATG
CCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGG
GCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGC
TGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAG
GATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAA
CCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATC
GGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCA
ACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAGG
ATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGG
GGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGA
TTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGC
TTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTG
TCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAA
AAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGAT
ATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTT
TTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTC
AACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCC
TAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCA
GACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAA
AAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTA
CGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCT
GACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTT
TCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCA
CGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGG
GGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAA
GGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAATGCTATTCTTTTCCAAAT
GTCCTCCAGCTTATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGG
AGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGT
CAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGTTCCTCCTGTAAATTTCTGCTACA
TCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTC
AGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGTGAATG
TCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTG
ATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTC
AAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCC
TGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGG
AGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAA
AATCATGCTCAGAGAGGTTATGCTGAGGCCCCCTGTGGGAAAGTCCTTTGGCCCAGCCTT
CCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCA
AAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTG
TCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATT
TCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGG
CAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGG
TTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACA
TGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGG
GAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCC
AGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTG
GACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAG
TAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAA
AATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCA
GGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAG
TGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGA
GGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGG
AGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCT
CCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTC
TTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAA
CCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATTCGTGCCTGTGGACACAGATT
CGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGA
CTGCCCGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGT
CTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTT
CGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCG
TCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTT
TCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTT
CTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTC
AGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTC
GAAGAGAGATGATGACATAAAAATCATGCTCAGTAGGATCCCGCTGAGGCCCAGAGAGAA
ACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCATTTGGATCCCTTTT
TCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCTTGG
CTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAA
GAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGT
GAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTT
TGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAA
GCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGG
GTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGT
GTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTG
CGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGA
CTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGA
GTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACT
AGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAG
GCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTT
GTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATAT
ACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTG
TCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGT
GTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATC
CCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGC
CCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGC
TCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTT
CTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCA
AATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAG
GGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAG
TGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGG
AAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTG
GTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGA
TGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGC
TGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCC
CATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGT
CAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAG
GAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATC
TGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGCTTTGCTGACAAGGCTGA
GGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGT
GGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGCAGTCGTCTGCGATAG
CCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGT
ATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAAC
TTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTT
TTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTT
CAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAG
GTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTT
TCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGAT
CAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTT
TGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCG
TTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAAC
TCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGT
CCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGT
GCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGG
GGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCG
GAGTCCTCTACGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAG
TCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGG
AAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTCACTTCTTTGC
CCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTA
CTCCCCGGGACACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGG
ATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGA
TGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATC
ATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGAT
CTGCTTTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTC
CTCCCTGACCGATTGTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTT
CGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGC
GGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCG
GGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCA
AGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCA
CTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATA
TTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAG
AGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGG
GCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGT
AGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAA
TACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGG
TCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTG
GAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTT
CCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCT
GGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGGGGTGAAAT
GAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTAT
TCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTG
CCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTT
CAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAA
ATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTG
CTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATG
TGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATC
TCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCT
TTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATC
CACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGA
TTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGA
TGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTG
GCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACC
AAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCC
TCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAG
GTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACA
CCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGA
CCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAA
TGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCT
ACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATG
TGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCA
GTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATG
AGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAA
CTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGG
AGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAG
CAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGA
ATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTT
GATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGA
CTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGG
GGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCCCA
GTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTG
GACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTC
TTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATC
TGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGT
GTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGA
ATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCG
AAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATG
TGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAAC
TTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCAGGTCAACGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGC
CCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTG
GATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTGTGGTCATGCT
GATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTC
ACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACAC
TTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTG
TCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGA
TAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGT
TCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGG
ATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCT
GTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTAT
TGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCAC
CACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAG
CGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCA
GGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCT
TTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGA
TGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGA
TTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAAT
TTTAACAAGTGTTGGCAGAATTCTTGGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTG
ATTTGAAGATCCCCCGGTGCTGGGGACTTCTTGGGTGCCATTTCCCGGGAGTCCGCACAC
ATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGC
AATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCT
CTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCC
CAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAA
GCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTT
TCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGC
CCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGG
AAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGC
TGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCA
GAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTT
AGAGCGGACTCCCATTTTGATTTCTTTCACCTTGGAACCAAGTAATCCAAAAGACCCTGG
GTGGACCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGC
ACATACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGA
TTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGG
TTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCCTGGTTGAACT
AAGTGGCGGTGATGTGCGTGGAGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGC
GCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCCTACCGAAATGGGAGA
AACGGCCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGA
GCTCTACAGGAGACTGGTCAACCTTGCTGTTAATTGAAAGCGTGTGTCAGTTGCGGCTGG
ACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGT
AGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAA
ATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAG
GTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGT
GCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAG
GTATCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGG
AGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCT
CCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTC
TTGGTGAAAGCCACTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGA
ACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGAT
TCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGG
ACTTCCTGAGTGACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGC
GTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGAT
TTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCT
CGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGT
TTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGACACCGGAAGAAGGATGTGCGAAC
CTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGA
CTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGT
CTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGA
GAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCT
TTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCT
TGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCG
AAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACA
AGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTG
CTTTGAAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTA
GGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCCGGTTCCCA
GTCGGAGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGA
GGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTG
TCAGTTGCGACTGGACTCTTAGGATCTCCAGAGGCGCTCTTTCCCAGACATCTTGGTATT
GGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACC
ACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGC
GTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAG
GCAAATGCAAGGCATAACTGCCTGCCTTTCCACCATGTGGAAAAGATCATTTTTCTTGAC
AGATCTTTGGGAATCTTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCCACGGG
ATCCTCTGAATGCTTTGATATACGGGAGAGAGATGTGTTCCCTCTCTGGGGATTATTGGG
GCCTGAGGTAGATTCGATTGTGTCTCTCCCATGGCTCAGTGGTGAAATGAAAGCGTTGAA
GGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAAT
GTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGG
AGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGT
CAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACA
TCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTC
AGCAGACTCCCCCAGTGGGTTGGCAAATGGACTGTTCTTGAATTTTGTCCATGTGTTCGC
GAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCT
TACTGATTTCCCTCTTTTCAAAGGGTTAGTGAGGGTCGATGTCTCTTGTGCCGGCTTTCA
TGGGGGTCAAAGCCAACTGACCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATTCC
ACTGTCCTTCCCTGCGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGG
GATTTTTCCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAG
AGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGAGGAAAGTCC
TTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTG
CACCAAGTAAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCT
TTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGAC
AAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGG
ATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTG
CTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCA
GAGAATGCCGAAAAATGTGCGCTGGGGTCGTCTGCGATAGCACTGGGTCCAAGTCCGATA
GGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAT
GAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGT
GTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAAT
TGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCAC
AGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGG
GTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAG
TGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTC
GTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTG
ATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGG
CCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGGACCATCTGAGGGTTAGGC
AAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCT
GGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTT
AGGAATCAGAGAATGCTGAAACATGTGCGCTGCAGTCGTCTGCGATAGCCTGGGTCCAAG
TCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGA
TATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTG
AAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATC
TTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTA
GCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGA
CACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTC
TAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTAC
AGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAA
TCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAAT
GAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCC
TAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCAT
TTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGG
ATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAAT
GAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATG
CCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGG
GCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGC
TGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAG
GATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAA
CCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATC
GGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCA
ACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAGG
ATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGG
GGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGA
TTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGC
TTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTG
TCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAA
AAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGAT
ATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTT
TTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTC
AACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCC
TAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCA
GACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAA
AAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTA
CGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCT
GACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTT
TCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCA
CGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGG
GGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAA
GGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAAT
GTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGG
AGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGT
CAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACA
TCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTC
AGCAGACTCCCCCAGTGGGGTTGCCAAATGGCTTGTCTTGGATTTTGTCCATGTGTTCGC
GAATGTCTGGCTGAAAGCCTAGCCTTAGGAGAAAGTAGAGTTTCTCTTCTGGGATCTCTG
TCTTACTGATTTCCCCTTTTCCAAAGGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTT
CATGGGGGTCAAGGCCAAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATC
CACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGA
TTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGA
TGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTG
GCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACC
AAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCC
TCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAG
GTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACA
CCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGA
CCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAA
TGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCT
ACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATG
TGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCA
GTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATG
AGCGACTCAGGGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGAT
AACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCA
GGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAA
AGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTG
GAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGG
TTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTG
GACTGTGTCTCTCCATGGCACAAGGTTGAAATCAAACTCTGGAAATGCCTAGTTGAATTT
GGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCC
CAGTTTTAGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTG
TGGACACAGATTCGGCTTCCTCGTAGACATAAGCCCGGGGCTGATCAAATGAATAGCCTG
TTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTG
ATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTG
TGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAA
TGAATGTCTCTGGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGG
TCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGG
ATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGG
AACTTGAAGACTCAGGTGATTTCTCCCTGGGATTGAGATGTCTCGGGTCAACGAAGACAC
CTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAGGATCCCGCTGA
GGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGT
TTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTGTGGTCAT
GCTGATTCCTTGGCTCTTTATTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGA
GATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGT
GACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAG
ACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGG
GTGATAGTTAGAGCACAGACTAGAGATTTCACTGAGTATTTTGCTAGTCAGTCCCAGTCG
AGTATGCCTACGTAGTTTGAGATATTTTCACTCTCAACTCTTTACGGGATGGGAGTGTGT
AGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCG
ACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACT
GGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGT
CAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAG
TTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGC
ATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGT
AGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATAC
GGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTC
TCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGT
TGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCC
CCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCC
GTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTC
CTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCT
GAATATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAA
TGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGG
AAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTG
AGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAA
GATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGT
AAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATG
ACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTG
AGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCA
TTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCA
GGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGA
GTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTG
ACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGG
CATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGG
GTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCC
TGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTAT
TTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTT
GCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTT
CCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCA
AGTAAAGGTAGCTGCACAGATAGCTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGT
GTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTC
CCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCA
GTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTG
TGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATT
CTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTC
TGGCAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCC
CACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGC
TCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCATAGACATTAGCCGGGG
CTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGA
GTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTC
TCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAA
AAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCC
TTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACT
CCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGAT
GGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATG
TCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCAT
GCTCAGTAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCT
GCTTTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCT
CCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCG
AAAGACCTGCTTTCAGGAGATTCACCACCAAAAGAACTCAAGGTGAGTGAATGACGGCGG
TTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAACCCAAGAGGCAGTCGGG
TTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAG
TGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACT
TGAGTAACTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAAGATT
TTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAG
AGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGC
CTCTTCCCAGACATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATT
CATAAAAGTAAATGCCAGGAGTCAATACCATTTGGGTTACGGGGGTCGCGAAGGATCATG
AGCTAGTTTTCGGGGTTCTTACCACAGGAGGTCAGTGTTATGCTGACCCGTCTACTCAGG
CATGCAGGCATAAACTGGTTCCTTTCAACATGTGAAATGATCATTTTTCTTGACCAGATC
TTTGGAATCTAGTAGAGATTCCATAGAACTCCTTTTTCCGTGTGCCCCCGCGGGATCCTC
TGAAGACTTGATATACGGGAGGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAG
GTAGATCGATGTGTCTCTCCATGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCA
ATTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTG
ATTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACAT
TGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAA
TGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGAGACCTCT
CTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCA
GTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGC
CTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTC
AAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCC
GGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAA
GACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTG
GGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGA
GAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAG
AGCGGACTCCCATTTTGATTTCTTTCACCCTGCACCCAAGTAATCCCAAAAGACCTTGGG
TGGCCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAAGC
ACAACCATGCCTCCGAGGAGTTCCAACCGTTGCGAGGACAAAAGGTGAGGGATTTTCCCG
TGATTTGCCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGT
AGGGTTTGCTGACAAGGCTGAGGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTG
ACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGT
GCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAG
GAAACGGCCAACTAGAACCAATGTATTTTCCCCAAGATATTTAGGAGATGTGAATGGCCC
AGAGCTCTACCAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCT
GGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGGATGAAGCGACT
CAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATA
GAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTT
TCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGT
AAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGT
AGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAAC
AGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTC
TCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAA
TTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGG
GAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAG
ATTCGGCTTCCTCATAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTG
GGACTGCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACG
CGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGA
TTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTC
TCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTG
TTTTCCTGCTTTCATGAGGGTCATAGCTACTCTCCCGGGAAACCGGAAGAGGATGTGCGA
ACCTTCTCATCCTGCAGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGGAACTTG
AAGACTCAGGTGATTTCTCCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAA
CTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCC
AGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGA
TCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGA
TTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCAC
CACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTT
AGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTC
CCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATA
GTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTC
CCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGAT
GGAGACGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCT
GTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTAT
TGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCAC
CACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAG
CGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCA
GGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCT
TTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGA
TGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTCTTTTCCAAATGTCCTACAGCTGATAGGAAGATCCCCCGATGCTGGGG
GACTATTTGGAGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATA
GTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAAATGGCAAAGGCTCCTTTTGCCTG
AGTCATCCTGTAAATTTCTGCTACATCCAGAGACCTATCTGCCATCTTCTGAATATTGCA
TGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTT
GATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTT
CTCTTCTGGGATCTCTGCCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGT
CTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGT
GAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTC
AGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTG
TCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTG
GGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCCCCCAGAGCGGACTCCCCTTTTTGATT
TCTTTCACCATGCACCAAGTAATCCAAAAGACCTGGGTGAGCCGATTTTAGTCAGAGCTG
ATTCCTTAGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCGTCCGAGAAGTTCA
CCGTTGCGAGGACAAAAGATGAGGAATTTCCCGTGATTTGCCCTGGCCCCATCTGACACT
TAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGT
CCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGA
TACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCATCTGCGATAGCCTGGGT
CCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCC
CAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGT
AATTCAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGT
GTATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAACTGGCTCCAGCTTTCAAGTAA
AGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCCAGGGTCGATGCCCAGGTGTG
AAGGGGACACGAGGGTCCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCC
TGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGT
GTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTG
CCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCT
TTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTG
GCAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCACTCTTCCGAGTGTCCCA
CAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTC
GTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCT
GATCAAATGAATAGCCTGTTCTTGGCTGGGACTGCCTGAGTACTTTTCTCCATTCGGAGT
CCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTC
ACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAA
AGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTT
CCTCAAAGGATTGAAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAACTACTCC
CCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGG
ACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTC
TCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGC
TCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGC
TTTAGAGGAGACCCCCATTTGGAGCCTCCCAGAAAAAAAAAGTTCCCAAAAACTCCTCCC
TGACCGATATTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTTTCATTTCAAAA
GACCAACTTTCCAGAGATTCCCCAAAGCAAGAACTCCATGTCAGCTAATCCCCACAGTTT
TCCCTTCTCTCTGGCGACACTTTCACAAGTGAAAATGGAGCCCAAGACACAGTCAAGTTT
CCGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCTCATCCAC
TGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTATTGCATCTTCAGGTCTCAGGGGATT
TTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATG
ATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGC
CCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAA
GTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTC
TTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGT
GAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACC
GCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACC
TTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATG
CTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCTCAAGTCCGATAGGGCCTA
CCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGT
GAATGGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCA
GTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTTCCCGTGAATCTTGAAATTGGAT
GAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATA
ACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAG
GAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAA
GCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGG
AATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGT
TGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGG
ACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTG
GGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCCC
AGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGT
GGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTT
CTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGAT
CTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTG
TGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATG
AATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTC
GAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGAT
GTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAA
CTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCT
CAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGG
CCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTT
GGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGC
TGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATT
CACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACA
CTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGT
GTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGG
ATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGG
TTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGG
GATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCC
TGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTA
TTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCA
CCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGA
GCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATC
AGGCAATGCAGGCATAACTGCTGCCCTTTCCACATGTGGAAAGATCATTTTCTTGACAGA
TCTTTGGAATCTTGTAGAGATTCCATAGAAACCTCCTTTTCCGTGTGCCCCACGGGATCC
TCTGATGCTTGATATACAGGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTG
AGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTG
TGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTC
CAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCG
CACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCT
TAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCTACATCCAGA
GACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGA
CTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGC
TGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCC
CCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCA
ACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTG
GAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGAT
ATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCAT
GCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCT
TCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCT
GGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCCTTTTGTGTCCTTTAG
CAAAACCTGCCTCCGAGGAGTTCATCGTTCCGAGGACAAAAGGTGAGGGATTTCCCGTGA
TTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGG
TTTGCTGACAAGGCTGAGGCATGTTCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAA
GTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCT
GGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCAAAATGGGAGAAACG
GCCAACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCT
ACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCA
GGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGA
TAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAA
GTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATG
CCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCT
TGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCAT
AAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATG
TGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCA
CAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAA
AGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCCCAGTTTTGGGAACCCTTGGA
TGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCC
TCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGA
GTACGTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTT
CTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTC
TTTTGGGCTATACGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGT
CTGACTTACTTCTTTGCCCTTCCTCTAGGATTGATGGGTCTAAGTTTTTTCTGGAGCTTT
CATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTG
CGTGATTGCGGGCTGGATGGACGATACCGGTGGTGAGGAACTTGAAGACTCAGGTGATTT
CTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGA
TGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTT
CCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTGTTTCCTCCACC
AAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTCG
TCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAG
GTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGA
GCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGA
CCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAA
CCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTA
CGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCT
CTACTGAAGAAACCAGAGAGACTTGCCCTATTTGAAAGCCTGTGTCAGTTGCGACTGGAC
TCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAG
CCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAG
CTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGG
TTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTG
CTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATT
CCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGA
GATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCAT
GGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGA
ATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGC
TGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACG
CATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATT
GCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTCCAAATAGCTGT
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAG
TTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGAT
TCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACC
GTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTA
GGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCC
CCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATA
CTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCC
AAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCA
AGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAA
TTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGA
ATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAG
GTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGG
GGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAG
CTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCC
TACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAG
GAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGG
AATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAAT
GCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCT
CATTTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCA
CGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCA
AATGAATAGCCTGTTCTTGGCTGGGACTGCCCGAGTACTTTTCTCCATTCGGAGTCCTCT
ATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAA
TGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCAT
AGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCA
AAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGG
AAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGAT
ATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGG
TCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAAT
AGGATCCCGCCGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAG
AGGGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGAC
CGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTCGAAAGACC
TGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCC
TTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTG
GAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGT
GATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAA
TTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACT
CTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTG
CCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTC
CCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAA
GAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCG
GTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCT
GCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCA
TTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCC
CCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTAT
TGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTT
GAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAATGCTATTCTTTTCCA
AATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCC
GGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATC
AGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCT
ACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTGCTGGTCAT
GGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGC
GAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCT
TACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGG
GGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTC
CTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCC
TGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGAC
CTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGC
CTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAAT
CCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTT
GTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCAAGGACAAAAGGTGAGGG
ATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAA
AGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCC
TGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAA
ACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAA
TGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGG
CCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGG
CTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACT
CAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATA
GAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTT
TCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGT
AAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGT
AGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAAC
AGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTC
TCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAA
TTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCCCAGTTTTGG
GAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCTGTGCCTGTGGACACAG
ATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTG
GGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACG
CGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGA
TTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTC
TCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTG
TTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAAC
CTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGA
CTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGT
CTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGA
GAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCT
TTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCT
TGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCG
AAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACA
AGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTG
CTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAG
GAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGT
CGGGTATGTCTACGGAAGTCTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAG
TGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAG
TTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGA
AGACTGGAATAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATC
TGAGTCAAAAAGCTAATGCCAGGCTCAATAACATTCGGTACGTGGGTCGCGAGCGTCATG
ACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATG
CAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAAT
CTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGA
TATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATT
GTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACA
AGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAG
ATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAG
TGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAA
GGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTT
CTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTT
GCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCT
TAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGT
TAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAAC
TGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTT
GTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAA
TGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTA
TGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGAC
TCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTT
GGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCC
GAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCC
ATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGC
TGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTG
CGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGCAGTCGTCTGCGA
TAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAA
TGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTC
AACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCG
CTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGC
TTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGC
CAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCAT
GTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGA
GATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCT
CTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTC
CCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTAAAATGA
AACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAG
TGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGA
AGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGC
CGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCAT
TCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAG
CAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATG
TGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTT
TGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAG
CTACTCCCCGGGAAACCGGAAGAGGATGTGTGAACCTTCTCATCCTGCGTGATTGCGGGC
TGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTG
AGATGTCTCGGGTCAACGAAGACACCTTCAACTTTGTCTCGAAGAGAGATGATGACATAA
AAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTA
ATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTGTTTCCTCCACCAAGTGATCAAA
AACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGT
CATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATG
ACAGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGC
AGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATT
GACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAAT
TTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGGAAGTTTGA
GAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAA
ACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCT
CCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTC
GCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGG
CTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACA
GGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCAC
ATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTC
CTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCC
TCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGT
GAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAA
GCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTT
GGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCT
GCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCC
TGTAAATTTGTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTC
TCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGT
CCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTG
GGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTG
CCGCTTTCATGGGGGTCAAGGCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTC
TCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCA
GGGGATTTTTCCTGGGGAGTGATATGAGCTGGGGGTCAATGATGACATAATCTGTCTGGA
AGAGAGATGATGACCTTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAA
GTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGAGACTCCCCATTTTGATTTCTTT
CACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTG
GCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCG
AGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAG
TGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGT
GTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGG
AATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCC
GATAGGGCCTACCAAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATAT
TTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAA
GCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTG
AAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCT
GCACAGATAACTGCATAGAAAATCTAAAGTCGGGGTCGATGCCAGGTGTGAAGGGGACAC
GAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAG
ACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTAGAGA
GTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCC
TCTGATGGTTGCTAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAG
GTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAAATCTGGCAATGCCTAG
TTGAATTTGGGGCCAAATTCTTGGTGAAAGCACTCTTCCGAGTGTCCCACAGCTCATTTG
AAGATCCCCAGTTTTCGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATC
CGTGCCTGTGGACACAGATTCGGCTTACCTCGTAGACATTAGCCGGGGCTGATCAAATGA
ATAGCCTGTTCTGGCTGGACTGCTGAGTACTTTCTCCATCGAGTCCTCTATGCCTGTCTG
ATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTG
TGTGTCTTGATTTCGTCCCTCCTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAA
TGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGG
TCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGG
ATATGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGG
AACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACAC
CTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGTATCCCGCTGA
GGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGAACCCCCGTT
TGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATG
CTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGAT
TCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGAT
ACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACG
TGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTG
GATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCG
GTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACG
GGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGC
CTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGT
ATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGC
ACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCG
AGCGTCATGAGTAGTTTCAGTTCATACCACAGGAGGGCAGGATCTGCTGACAGTCTAATC
AGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAGGATCATTTTCTTGACAGATC
TTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTG
ATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAG
ATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAA
TTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTG
ATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACA
TTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCA
ATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTC
TCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCC
AGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAG
CCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTT
CAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGGCAACTGCC
CGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGA
AGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCT
GGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAG
AGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTA
GAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGG
CCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCAAAAC
CTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCC
CTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCT
GACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCG
GTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAACATATGCGCTGGAGTC
GTCTGCGATAGCCTGGGTCCAAGTCCGATACGGCCTACCGAAATGGGAGAAACGGCCAAC
TAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGA
GACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTT
GCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTG
GCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGG
GTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAG
GAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACA
TGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACT
CCTCCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCC
CTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGG
TGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCT
CTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCAT
TTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAG
ACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTT
TTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCA
AGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGAGTCTTGATTTCGTCCCTCTTTTGG
GCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGATT
CACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGA
GGGTCAAGCTACTCCCCGGGACACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGA
TTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCC
GGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATG
ACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCTCTA
ACGTTAATGATCTGCTTTAGAGGGGACTCCTCGTTTGGATCCCTTTTTCCTCCACCAAGT
GATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTT
TTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGA
GTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGATACTTAGACAAGTGAAAATGGAACCC
AAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTG
ACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTA
GAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGA
AGTTTGAGAAGATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTAC
TGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTT
AGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTG
ACACCTCGCTGTAGCATTCAGGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAA
TGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCA
TACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAAATGCAAGGCATAACTGCT
GCCTTTCCACCATGTGGAAAGATCGTTTTCTTGACAGATCTTTGGGAATCTTTGTAGAGA
TTCCATAGAACTCGTTTTCCGTGTGCCCCACGGGATCCTCTGAATGCTTTGATATACGGG
AGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCT
CCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGG
CAGGATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCG
GAGCTGGGAACTCTTGGGTGTCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTG
GACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTT
TTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAA
TATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGG
CTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCCTAGGGAAG
TGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGG
TCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGAT
GATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAG
CATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACA
TAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGG
CCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTT
TGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGC
TGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTT
CACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACA
CTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCAT
GTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGG
GTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTT
CCCAAGATATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCT
GTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCAGGGCGCTTTTCCC
GTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGT
AAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTG
AAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCT
GGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTG
TTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGC
CAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTT
TGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGG
AAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCAC
AGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCG
TGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTG
ATCAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTC
CTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCA
CTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAA
GCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTC
CTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCC
CGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGA
CGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCT
CGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCT
CAGTAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCT
TTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCC
TGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAA
GACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTT
TCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTT
TGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGG
CGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGA
GTAATTTTTGCTAGTCCGGTTCCCAGTCGGGCATGTCTACGGAAGTTTGAGAATATTTTC
AACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGA
CTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTC
TTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCAT
TCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCA
TTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGG
ATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAG
ATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTG
TGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGA
TTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAG
CGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTT
TCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATT
TCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACA
CATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTC
TGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTGCTGTC
ATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTC
GCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGT
CTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCAT
GGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTG
TCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTT
CCTGGGGAGTGATATGGCTGGGGTCAATGCTGACATAATCTGTCTGGAAGAGAGATGATG
ACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCA
GCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTA
ATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTT
TTGTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAG
GGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCTCA
GAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTTCCCTGGTGTTTGCTTGACCTTG
CCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTG
AAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGA
AATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAAT
GGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGC
GACTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGA
CTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCA
TAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCAC
TTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGC
GTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCT
GTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGAAATCCTCTGATGGTTGATAA
ACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTG
TCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCA
AATTCTAGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTT
GGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACAC
AGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGC
TGGGACTTCCTGAGTACGTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCA
CGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTT
GATTTCGTCTCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTC
TCTCGTCTGATGTCTGACTTACTTCTTTGCCTTCCTCAAAGGATTGCAAGGTCGAAGCCT
GTTTTCTTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAA
CCTTCTCATTCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAG
ACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTG
TCTCGAAGAGAGATGATGACATAAAAATCATGCTCAGTAGGATCCCGCTGAGGCCCAGAG
AGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCC
TTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCTGATTCC
TTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACC
GAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGATACTTAGAC
AAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCT
GCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTA
GGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAG
TCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGA
GTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCA
GTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATG
AAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTAT
CTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCAT
GACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAAT
GCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAA
TCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTG
ATGTACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGAT
TGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAAC
AAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAA
GATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACA
GTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAA
AGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCT
TCTTCTGAATATTGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGCGGGT
TGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCC
TTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGG
TTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAA
CTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATT
TGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCA
ATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTT
ATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGA
CTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTT
TGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTC
CGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCC
CATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGG
CTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGT
GCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCG
ATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCCAACTAGAAC
AATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGG
TCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGCGGGG
CGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCA
GCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGAT
GCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTC
ATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCA
GAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTCCT
CTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGT
TCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAAA
CAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCG
AGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTG
GAAGTGCTCGTGCACGGATCCTGCTGGGAACAATNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCAGTCTCACTAATGGG
CGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTAGAAAAAAGCATAGC
TGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAG
AATTGCAAGATCGAAGCCTGTTTTCCCTGCTTTCATGAGAGATCAAGCTACTCCCCGAGA
AACCGGAAGAGAATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATA
TCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGAGATTGAGATGTCTCAGGT
CAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATA
GGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGA
GGAGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACC
GATTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTAGAAAGACCT
GCTTTCAGGTGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCT
TGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGG
AAAAGCCGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTG
ATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAAT
TTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAATTTTTGAGAATATTTTCAACT
CTCAACTATTTACGCGATGGGAGTGTCTAGCAGCTCTACTGGAGAAACCAGAGAGACTTG
CCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCATCTTTC
CCAGACATCTTGGTATTGGGTGAAGAACTGAGTAGTCCGACACCTCGCTGTAGCATTCAA
GAAAAGGCAGCAGCACCAATATTTGAGTCACAAAGCTAATGTCAGGTTCAATACCATTCG
GTAAGTGGGTCGCGAGCGTCATGACTCGTTTCAGGTTCATGCAACAGAAGGTCAGGATCT
GCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCA
TTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACACCTTTTCCGTGTGCC
CCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTAT
TGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTT
GAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCA
AATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCC
GGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATC
AGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTGTGCT
ACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGG
GTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGA
ATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTA
CTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGG
GTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCT
TCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTG
GGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCT
AAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCT
TCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCC
AAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGT
GTCCTCTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGAT
TTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAG
GCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTG
GTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAAC
ATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATACGGCCTACCGAAATG
GGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGATGTGAATGGCC
CAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGAC
CTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACT
CAGTAGTCTGATAGTTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATA
GAAAATCTAAAGTCAGGGTCGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved