Loxodonta_africana Locus Mono:66:SNORD116
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:66:SNORD116
Loxodonta_africana
Mono:66:SNORD116
scaffold_197408
SNORD116
1001..1093
1245
CATTTCACTGAGGGTTCTCCGTATTCTGGAGAGGGGAGGTTTCCTGCACATGTAAAGAG
TCAGTTTGAGTTGGTCTCTTGAGTATGGTCTCTTCAGTCACTCAGCACCAGTCCTTGGCC
AGAGTCACAGATTTGCCTACCATATTTCATCGCCAGGTCTTTAATTTCTTCTGTTCCTTG
GTTGTATTGATAAAAGGCAGCTTATTAATTTTGCACTGCTTCCAGAGTCACAGAGTTGGC
ACTGGTTTGTGATGTTTTGTGAGGAAGTGTAAATAACTGCAGGCCAGGAGTTTCCATGGA
AATTTGTGACCCTGAGCCCAATGGACTCTGGCACTGTGGAAAATCCAGAAGCAGTCAGTC
AGTAACTTTACGTTTGCAAAGTCACCAATGTTCTGGAGCATGCCTGCAGGGTTTGGGACC
AAGGAATTGTCCAGTGGATGCTTTCAGACCCCTCCGAAGCTCTTAGCCCAAACAGACCAA
TACATGTATAAATTTGGTCATATCTCTGTATATTGCAGAAGAAAAGGGATATAGACAATA
TCCATATTTGGGAAACTGTTTATTTTTACTTGCTGAGCATGTACCTGTGGAAGCATCTCA
ACCATGGATACGTTTGCTGTATACGTTTTAGGTGGAGTTGCCTATGGAGAGATGACAACA
CAGCTCTCAAGATGGTTCCATCGTACCTGGAGATTCAAGGAAGCCCTTGGAATTGGTATG
GCCATGAGTCTGAAGAAAACAAGGAGATGGCTCAGGCAGTAAACATTTTTTTGGCCAGTG
TTATGGAGATGTTAAAGGGCATTGCATAGCCAGCAAGGCCTATTTCTTGTTTTTCATCAG
CTGCCATGCAGAGGTCCACTTGGTGTGTGCATTGGCCCTTTCCCAGTCTCACTGGTGTGG
TTCTTTATGCTCACCAGCACTGGAGACTTCTGAGGGCTCTGGCTGTGCAACCGCTGTACC
CTGTAGTAGGCACACAAGGGCATGTGCCTGTGAACGTGCATGGATTGATGATGACTGCTA
TCTAAACATTCCTTGGAAAAGCTGAACAAAATGAGTGAAAACTCCTTACCGTCTCACTCA
TTGAACTGAGGTCCAGCACATTTCACCAAGGCAGGGTAAATGAGTGAGGGACCATTTGTT
CATACCCCTGCCAATAAGAAGTGCCTGAACCCTTGCAAGCCTCAGTCTCACGGACAGTCG
AAACAAGTTTTCTCAGGTAGATGTCTAGTTCTAGCAGATTCCATGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved