Loxodonta_africana Locus Mono:5:SNORA35
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:5:SNORA35
Loxodonta_africana
Mono:5:SNORA35
scaffold_5112
SNORA35
1001..1130
2130
GTCAGAATCGACTCTACGGCAGTGGAAGCGATAAGGATGTAAGAAGAGGTAGAAATCAA
CGAAGCTGGTATTCAGAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTGATCCATGTGTGAGGTAGCCATGCTGAGTGAATGA
AGCAGTGGATCCTATAATGTTTCAGGTCTCCTACCCACCACCTCCTCCAAGATGGTTACT
TGGCCCAGAGCATAGGGTCCCAACCACAGCTTTGCAGTGTTCAGCACTGGCAAAGTGGCC
CATTGGGCTCCCTCTTGACCAATGGGCATCGAGCAGTGCAAAAGCAAATCCCACCATAAA
GCCGGGAGAGCCACACTGTGGGCTAACTCCTGCATGCAGGTGGGTACATGTGTCATGGGT
CCTGTGACCCTGCCTAAGAAAAAAGAGGAGGTGGAGAGACAAATCAAGCAGTTCAGTAAT
GGCTACTTCTAGGTAAAGGTGACTATACCAGGCTAAAAATAGGTGCTCAATAAATTTTGT
CATTATTATTAGTAGCTTTGTCATTTGTCACAGTTTATATTAACTTCTCTTAGACTCAAT
ATCCTATTCCATAAAATCAGGTTGACACTACTGGAATTACCTAAGGTTGTCATGTGGATT
ACATGACCAAATAAAAGCATTTAAATTCCCTGGCAAATAGACAATGCTCATTAAATGCTA
GTCAAACCCACTGCGGTCGAGTCAATTCCGACTCATAGCGACCCTATAGGACAGAGTAGA
ACTGTCCCATAGAGTTTCCAAGGAGTGCCTGGTGGATTTGAACTGCCGACCATTTGGTTA
GAAGCCGTAGCACTTAACCACTACGCCACGAGGGTTTCCTTAAATGCTAGTAGGACAAGA
GAAATCAGTTGTTTTCTCCTTTTGATACGATGAAAATGGGATTGTGATTGTCTTCCGGAT
ATTCGTCCCAGTGTATTTTATTTGCCTGACATTCCTACTAGCTTTATGACAACATAGCCT
CCCCCAGACTCTTTGTTCTGTGTACATAACACTCTACTTAGACCTAGTGTTGACAAAATT
CCCTTTCCAATTCAATCTTATAATATAGAGCTACATTTTTCAAGACCCATTCCTGGTCCC
TGCTTTCTTCCATGTTTCCTTTCCTGAATATTTCAGCCCCACTAAACCTCTCCCTCTACT
ACATAGTTTGGCAATTTCCCATTTTTTTTTATTCATTTATTGTATTATCTTTTCAGCTGA
TTTGTAACCTCTTTGAAAGCAAGGACTGTGTCTTCTCGTACATTTTAGTATTCACTGCAG
CACCTACCACAGTGCCTTGCATAAGGTAGAATCTCAATAAATGATCATTTATTGAGAAGT
CAATGCCAATTATCAGTGAAGTCAGTCGACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved