Loxodonta_africana Locus Poly:16:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:16:SNORD115
Loxodonta_africana
Poly:16:SNORD115
scaffold_68340
SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2706..2786, 6190..6270, 7888..7965
8258
ACAGAAGTGTGTGTATGATTTTGTCCCTAATTTGGGCTATATGTGGAAAAAGCATAGCT
ATTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTAAAAGG
ATTGCAAGGTCGAAGCCTGTTTTACTGCTTTCATGAGGGTCAAGCTACTCCCCGGGACAC
CGGAAGAGGAAGTGAAGAACATTCTCCTCCTGCGTGATTGCGAGCTGGAAGGACGATGTC
AGTGGTGAGGACCTTGAGGACTCAAGTGATTTTTCCCGGGGTTTGAGATGTCTCGGGTCA
ATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCACAATAGG
ATCACGCTGAGGTCCAGAGAGAAACTCCTTTTCCCCAACGTTAATGATCTCCTTTAGAGT
GGATCCCCGTTTTGATCCCTTTTTCCATCACCAAGTGATCAGAAACTCCTCCCTGACCGA
TTTTGGTCAGGCTGTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCT
GCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCT
GGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGG
CAAAGCTGAGGCATGTCCCCTGGTGTGTGCTTGACTTTGCCTGGTTGACTAAGTGGCGGT
GATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAAAATGTGCGCTGGGGTCGT
CTTCGATAGCCTGGGTCCAAGTCCGATACGGCCTACCGAAATGGGAGAAACGGCCAACTA
GAAAAATGGGTTTTCCTGAGATATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGA
CTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGC
AGGGCGCTTTTCCCATGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGC
TCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCGTAGAAAATCTAAAGTCAGGGT
CGATGCCTAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCTACAG
GAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCCTAAGTGCTGCCTTGCACA
TGTGCAAAGATCACTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACT
CCTGCTCTCTTTGGGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCC
CTGTGTTGCCATTCTTGGGGAATGAGGTGGCCTGGAGTGTGTCTCTCCATGGCACAAGGT
TGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCACT
CTTCCGAGTGTCCCACAGCTCCTTTGAAGATCCCCAGTTTTGGGAACCCGTGGATGTCAT
TTCCTGGAAGTGCTCGGCACGGATCCGTGCGTGGGGACACAGATTTGGCTTCCTTGTAGA
CATTAGCCGGGGCTGATCAAATGAAAAGCCTGTTCTTGGCTGGGACTGCCTGAGTATTTT
TCTCCATTCGGAGCCCTCTACGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAA
GGGGTCAGCAGTCTCACTAACGGGTCAGAAGTGTGTGTCTTGATTTTGTCCCTATTTTGG
GCTATATGTGGAAAAAGCATAGCTGTTAAGGCAATGAATGTCTCTCGTCTGATGTCTGAC
TTACTTCTTTGCCCTTCCTAAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATG
AGGGGTCAAGCTACTCCCCGGGACACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGT
GATTGCGGGCTGGATGGACGATATCAGTGGTGAGGACCTTGAGGACTCAGGTGATTTTTC
CCGGGGTTTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGA
TGACATAAAAATCATGCACAATAGGATCACGCTGAGGCCCAGAGAGAAACTCCTTTTCCC
CAACGTTAATGATCTCCTTTAGAGTGGACCCCCGTTTTGATCCCTTTTTCCATCACCAAG
TGATCAGAAACTCCTCCCTGACCGAATTTTCTCATGCTGATTCCTTGGCTCTTTTCCTCT
TTGTCTGTGATTTAGAAAGACCTGCTTTCAAGAGGTTCACCACCGGAAGAACTCAAGGTG
AGTAAATGACGGCGGTTTTCCCTTGTCCCTGGGGATACCTAGACAAGTGAATATGGAGCC
CAAGAGGCAGTCGGGTTTTGTGGAAAGGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCT
GACCGATTGACCAAGGGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCT
AGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGG
AATTTTTGAGAATATTTTCAACTCTCAACTATTTACGCGATGGGAGTGTGTAGCAGCTCT
ACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTC
TTAGAATCTCCAGGGCATCTTTCCCAGACATCTTGGTATTGGGTGAAGAATTGAGTAGCC
TGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATTTGAGTCAAAAAGCT
AATGTCAGGTTCAATACCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCGTTTCAGGTT
CATGCCACAGGAGGTCAGGATCTGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCT
GCCTTCCACATGTGCAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCC
GTAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGA
TGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGCGTCTCTCCATGG
CCCGGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAAT
TCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTACTG
GGGACTCTTGGGTGCCATTTCCCCGGAGTCCGCACACGCTGGACAGTGCCCGTGGACGCA
TATCTGGCTGCCTTCAACACCTCAGTCAGGCTTAATCAATTGCAAAGTCTCCTTTTGCCT
GGGTCCTCCTGAAAATTTGTGCTGCATCCAGAGACCTCTATGCCTTGTTCTGAATATTGC
ATGATTCTCTCCTTCTGTCATGGGTCGGCAGACTCCCCAGTGGGTTGCAAATGGCTGCCT
TGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTT
TCTCTTCTGGGATCTCTGTCTTACTGATTCCCCTTTCAAAGGGTTAGTGAGGTCGANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGCTTTGGAGGCAGCTAATGCT
TGGAGGCAGTTAACCTTTGGGCCAACAGTGTCCTGCTGTTGGGCTGCAGTTTCTTTGCCC
CCCTCAGCCCTGCCTGTGCCTCCAGCTCCCCGCTCCTGCAGCCGTAGGCCCTGAGGAATC
TCCGGCCGCTATCCCCGGCCACCCTGAACTAGGTGCCTGGCCTGGCTGCAGTCAGCCTGC
AAGTGTGTGAGCAGGACTTTCCTGGGGGCAGCACGGGCCTCTAGGCCACCACTCCCAGCT
CCTGGCGCTCATACAGGTCCCCAAACAAACCACCTCCAAGGAGAAAGCCCTCTCCCACTC
CTCTGCTCCGGAAATGGGACACAGAGAAGGGAGTGCTTTCTGGGGTAGCTTGGAGGTAAT
TTTCCTGGATTATAACGTGGGGTGGGGGCCAGGACGAAGAGCGAGGAGCTGGAGACACCT
AGCTTCCTCTCTGGGTTCCACTCCATGGGCACTGTGAGGTATGGGGTGTGTGTGTTTGTG
TGTGTGCGTGTATGTGTGTGTGTATGCGTGTGTGTGCACAAAGGCTTGTGTACATGTGTA
TTCCAGCATGGGTCTCCGAGCCTGTGTTAGCTGCGTGCACGCCTGCGTGTATATGTTTGT
TTCTGGAAGTGTGCCTGTGAGCATGTTTTGTGCTGCTGAGTGTGTGTGTGTGTGGGCGAG
CGTGTAACCTTGTAAGCCCATTGCTACTGGTTTTCATGCGACCTGTGCTGGGGTGAGCTC
TCCAGGAGACCGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGTTGGACTCGT
AGGATTTGCAGGGCGCTTTTCCCATGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTG
ATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCGTAGAAAATCTAA
AGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGAT
GCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCCTAAGTGCTGCC
TTGCACATGTGCAAAGATCACTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCA
TAAGACTCCTGCTCTCTTTGGGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGAT
GTGTTCCCTGTGTTGCCATTCTTGGGGAATGAGGTGGCCTGGAGTGTGTCTCTCCATGGC
ACAAGGTTGAAATCAAACTCTGGAAATGCCTAGTGGAATTTCGGGCCAAATTCTTGGTGA
AAGCACTCTTCCGAGTGTCCCACAGCTCCTTTGAAGATCCCCAGTTTTGGGAACCCGTGG
ATGTCATTTCCTGGAAGTGCTCGGCACGGATCCGTGCGTGGGGACACAGATTTGGCTTCC
TTGTAGACATTAGCCGGGGCTGATCAAATGAAAAGCCTGTTCTTGGCTGGGACTGCCTGA
GTATTTTTCTCCATTCGGAGCCCTTTACGCCTTGTCTTGATCTGGCACGTGTCTGCCTTT
CTGTCAAGGGTCAGCAGTCTCACTAACGGGCCAGAAGTGTGTGTCTTGATTTTGTCCCTA
TTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGT
CTGACTTACTTCTTTGCCCTTCCTAAAAGGATTGCAAGGTCGAAGCCTGTTTTACTGCTT
TCATGAGGGTCAAGCTACTCCCCGGGACACCGGAAGAGGATGTGCGAACCTTCTCCTCCT
GCGTGATTGCGGGCTGGAAGGACGATGTCAGTGGTGAGGACCTTGAGGACTCAGGTGATT
TTTCCCGGGGTTTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAG
ATGATGACATAAAAATCATGCACAATAGGATCACGCTGAGGCCCAGAGAGAAACTCCTTT
TCCCCAACGTTAATGATCTCCTTTAGAGTGGACCCCCGTTTTGATCCCTTTTTCCATCAC
CAAGTGATCAGAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTC
CTCTTTGTCTGTGATTTAGAAAGACCTGCTTTCAAGAGGTTCACCACCGGAAGAACTCAA
GGTGAGTGAATGACGGCGGTTTTCCCTTGTCCCTGGGGATAACTAGACAAGTGAATATGG
AGCCCAAGAGGCAGTCGGGTTTTGTGGAAAGGCTGAGACGTGTCCCCTGCCTTGAGCTTG
ACCTGACCGATTGACCAAGGAGCGGTGATATGCACGGGTGGATCGTTAGGAAGCACAGGA
ACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGAGTATGTCT
ACGGAATTTTGAGAATATTTTCAACTCTCAACTATTACGCGATGGGAGTGTCTAGCAGCT
CTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGAC
TCTTAGGATCTCCAGGGCATCTTTCCCAGACATCTTGGTATTGGGTGAAGAATTGAGTAG
CCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATTTGAGTCAAAAAG
CTAATGTCAGGTTCGATACCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCGTTTCAGG
TTCATGCCACAGGAGGTCAGGATCTGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTG
CTGCCTTCCACATGTGGAAAGATCGTTTTCTTGACAGATCTTTGGAATCTTGTAGAGATT
CCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACAGGAGGA
GATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGCGTCTCTCCAT
GGCTCAGTGGTGAAATGAAGGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGA
ATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTAC
TGGGGACTCTTGCGTGCCATTTCCCGGGAGTCCGCACACGCTGGACAGTGCCCGTGGACG
CATATCTGGCTGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGTCTCCTTTTGC
CTGGGTCCTCCTGAAAATTTGTGCTGCATCCAGAGACCTCTATGCCTTGTTCTGAATATT
GCATGATTCTCTCCTTCTGTCATGGGTCGGCAGACTCCCCAGTGGGTTGCAAATGGCTGC
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAG
TTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTCTCTTGTCCCGCTTTCATGGCGGTCAAACCAACTGCCCGGGAAACGGGAAGACGATG
TGTGAACCCTCTCATCCACTGTCCTTCCTGCGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCGATGATGACATAAT
CTGTCTGGAAGGGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGAT
TCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTGCGAGGAGTTCACC
GTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGTCCCCATCTGACACTTA
GGCAAGTGAGGATACACCGCAAAAGGCAGTAGGTTTTGCTGGCAATGCTCAGGCATGCCC
CCTGGTGTGTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATA
CTTAGGAATCAGAGAATCCTGAAAAATGTGCGCTGGGGTCATCTTCGATAGCCTGGGTCC
GAGTCCGATACGGCCTACTGAATGGGAGAAACTTCCAACTAGAAAAATGGGTTTTCCTGA
GATATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACCGGTCAACTTGCTGTAAT
TGAAAGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCTTTTCCCATGAA
TCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGCAAAGG
TAGCTGCACAGATAACTGCGTAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGG
GACATGAGGGTCAGCAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGC
TCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATCACTGTTCCT
ACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGATTCCTGCTCTCTTTGTGCCAAGG
AATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTGTCATTCTCTGGGA
ATGAGGTGGCCTGGAGTGTGTCTCTCCATGGCACAAGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved