Loxodonta_africana Locus Poly:10:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:10:SNORD115
Loxodonta_africana
Poly:10:SNORD115
scaffold_29608
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1083, 2710..2787, 4407..4487, 6107..6184, 7861..7941, 9562..9639, 11261..11341, 12962..13039, 14658..14738, 16358..16435, 19712..19789
20625
GGGGGGCCGTGAAAGCGGGCGTAAGTGCTGTCTTGCACATGGGCAGAGATCAGTGTTCC
TACGGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAG
GAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCGTTCTTTGGG
AATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAAT
GCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCT
CATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCA
CGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATGA
AATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCT
ATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAA
TGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCAT
AGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCA
AAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGG
AAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGAT
ATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGG
TCAACGAAGACACCTCAACTTGTCCTCGTAAGAGAGATGATGACATAAAAATCATGCTCA
ATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTT
AGAGGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTG
ACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGA
CCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTC
CCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTG
TGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCG
GTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGT
AATTTTTGCTAGTCCTGGTTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCA
ACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGAC
TTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGATCTCTTAGGATCTCCAGGGGCCT
CTTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGC
ATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATAC
CATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCA
GGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAA
AGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCG
TGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGG
GATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAA
AGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCT
TTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCA
TTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAA
CACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATT
TCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTG
TCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGT
TCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCT
GTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTT
CATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCA
CTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATT
TTTCCTGAGAGAGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAG
ATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTT
GGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCAC
CAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTC
CTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAA
GGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATAC
ACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTG
ACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGA
ATGCTGAAACATATGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATACGGCC
TACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTATGAGAT
GTGAATGGCCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGT
CAGTTGCGGCTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGA
TGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCATAGAT
AACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCA
GGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGATAGTGAA
AGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTG
GAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGG
TTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTG
GACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTT
GGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAAATCCC
CAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTG
TGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGT
TCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGA
TCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGACGAGAAGTGT
GTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAAT
GAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGT
CGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGATACCGGAAGAGGA
TGTGTGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGA
ACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACC
TCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAG
GCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTT
TGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTCTGGTCATG
CTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGAT
TCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGAC
ACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACG
TGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTG
GATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCG
GTTCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACG
GGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGC
CTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGT
ATTGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGC
ACCACTATCTGAGTCAAAAAACTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCG
AGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAAT
CAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGAT
CTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCT
GATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTA
GATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCA
ATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCT
GATTTGAAGATCCCCCGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACAC
ATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGC
AATGGCAAAGGCTCCTTTTGCCTGGGTCCTCCTGTAAATTTCTGCTATATCCAGAGACCT
CTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCC
CAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAA
GCCTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTT
TCAAAGGAGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTG
CCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAG
GAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGG
CTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTC
AGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTT
TAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGT
GGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACA
ACCTGCCTCCGAGGAGTTCACACGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTT
GCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTT
GCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTG
GCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAAACATGTGCGCTGGA
GTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCC
AACTAGAACAATGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATGAAA
TAAGGCCAGGTTCCTGGGCTGGGAACTTCCGGGAGTAACTTTTCTCCATTTCGGAAGTTC
CTTCTATGCCCTTGTCTTGATCTGGCACGCGTTCTGCCCTTTCTGTCAATGGGTCAAGCA
GTCTCACTAATTGGTCGAGAAAGTGTGTGTCTTGAATTTCGTCCCTTCTTTTGGGTCTAT
ATGTTGAATAAAGCATAGCTGTTAGGCAATGGAATGTCTCTCGTCTGATGTCTGACTTTA
CTTCTTTGCCCTTCCTCAAAGGGATTGCAAGGTCGAAGCCTGTTTTCCCTGCTTTCATGA
GGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGA
TTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCC
GGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATG
ACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCACAGAGAAACTCCTTTTCCCTA
ACGTTAATGATCTGCTTTAGAGGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTT
ATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTT
TTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAG
TGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCA
AGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGA
CCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAG
AAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGCCTACGGAA
GTTTGAGAAGATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACT
GGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTA
GGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTAGCCTGA
TACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAAT
GCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCAT
ACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCC
TTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATA
GAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGT
GTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTC
AGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGGATTCT
TGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGA
ACTCTTGGGTGTCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAC
TTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTACCTGGG
TCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATG
ATTCTCCTCCTTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTT
GATTTTGTCCATGTGTTCGTGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAGTGAGTTT
CTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTGGTGAGGTCGATGT
CTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGT
GAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTC
AGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTG
TCTGGAAGAGAGATGATGACCTAAAAATAATGCTCAGAGAGGTTATGCTGAGGCCCTGTG
GGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTC
TTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCC
TTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTT
GCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGC
AAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCT
GGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTT
CGGAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAG
TCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGA
TATTTAGGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTG
AAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTGAGGGACGCTTTTCCCGTGAATC
TTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTA
GCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCA
CACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTC
TGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATCACTCCGCTCCT
ACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGG
AATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGA
ATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATG
CCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTC
ATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCAC
GGAACAGTGCCTGTGGACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAA
ATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTA
TGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAAT
GGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTA
GCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAA
AGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGA
AACCGGAAGAGGATGTGGGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATA
TCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTTTCCCGGGGATTGAAGATGTCTCGGG
TCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAAT
AGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAG
AGTGGACCCCCGTTGTGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGAC
CGATTTTGGCCATGCTGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACC
TGCTTTCAAGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCC
TTGTCTCTGGTGATACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTG
GAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGT
GATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAA
TTTTTGCTAGTCCGGTTCCCATGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAAC
TCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTT
GCCCGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTT
CCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGACACCTCGCTGTAGCATTCA
AGAAAATGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATT
CGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGAT
CTGCTGACGGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGAT
CATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCGTTTTCCGTGTG
CCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATT
ATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCG
TTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGGATTCTTGGAAAGCTATTCTTTTC
CAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGCTGGGAACTCTTGGGTGTCATTTC
CCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACA
TCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTACCTGGGTCCTCCTGTAAATTTGTG
CTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCAT
GGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGT
GAATGTCTGGCTGAAAGCATAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCT
TACTGATTTCCCCTTTTCAAAGGGTTGGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGG
GGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTC
CTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGTTTTTTCC
TGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGAC
CTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGC
CTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAAT
CCAAAAGACCTGGGTGGCCGACTTTGGACAGGCTGATTCCTTGGCTCTTTTCCTCCTTTT
GTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGG
ATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATAAACCGCAAA
AGGCAGTAGGGTTTGCTGACAAGGCTGAAGCATGTCCCCTGGTGTTTGCCTGACCTTGCC
TGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATGCTGAA
ACATGTGCGCTGGAGTCATCTGTGATAGCCTGGGTCCAGGTCCGATACGGCCTACCGAAA
TGGGAGAAACGGCCAACTCGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAAGGG
CTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATGGAAAGCGTGTGTCAGTTGCGG
CTGGAGTCGCAGGATTTGCAGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACT
CAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCGTA
GAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGTGGACACGAGTGTCAGGAGCACTT
TCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGT
AAGTGCTGCCTTGCACATGTGCAAAGATCACTGTTCCTACAGAGTTGGTTGGAATCCTGT
AGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAAC
AGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTC
TCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGGGGCCAAA
TTCTTGGTGAAAGCACTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGG
GAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTGGACACAG
ATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCCGTTCTTGGCTG
GGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACG
TGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTCGA
TTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGAATGTCTC
TCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCGAAGCCTG
TTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGGGAAC
CTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGA
CTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGT
CTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCAGAGA
GAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCGTTGTGATCCCT
TTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGCCATGCTGATTCCT
TGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGTGACCTGCTTTCAAGAGATTCACCACCG
AAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGATACTTAGACA
AGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTG
CTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAG
GAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGT
CGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAG
TGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCAGAGTTGAAAGCCTGTGTCAG
TTGCGACTGGACTCTTAGGATCTCTAGGGCATCTTTCCCAGACATCTCGGTATTGGATGA
AGAATTGAGTAGCCTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATC
TGAGTCAAAAAGCTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATG
ACTCATTTCAGGTTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATG
CAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAAT
CTTGTAGAGATTCCATAGAACTCCTTTTCCGTGTGCCCCACGAGGATCCTCTGATGCTTG
ATATCCAGGAGGAGATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGAT
TGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAAC
AAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAA
GATCCCCCGGTGCTGGGGACTCTTGCGTGCCATTTCCCGGGAGTCTGCACACATTGGACA
GTGCCCGTGGACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAA
AGGCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTCTGCCT
TCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGT
TGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCC
TTAGGGAAATGAGTTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGG
TTAGTGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAA
CTGGAAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATT
TGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCA
ATGATGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTT
ATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGA
CTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTT
TGGTCAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTC
CGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCC
CATCTGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAG
CTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGT
GCGTGGGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTTGCTGGAGTCATCTTCGA
TAGCCTGCGTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAA
CGTGTTTTCCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTC
AACTTGCTGTATTTGAACGCGTGTGTCAGTTGCGGTTGGGACTCGTAGGATTGCAGGGCC
GCATCTCCTCATGGATCTTGGAAGCTGGGATGAGCGACTCCAGGAGTCTCGACAGCTGGG
CTTCCAGCTTTTCAAGGTGGAAGGTAGCTGCACAGATAAGTGCATAAGATAATCTAAATG
TCAGGGTCGATGGCGAGGGGTGAAGGGGACAGGGAGGTTGAGGGAGGCACTTTCCAGGTT
CATTGTCCCAGGAAGTTCTGTTTTCCTGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTGGACACATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTC
CTTTTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCT
GAATATTGCGTGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAA
TGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGG
AAATGAGTTTCTCCTCTGGGATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAGTG
AGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGGAA
GATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGT
AAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATG
ACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTG
AGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCA
TTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCA
GGCTGATTCCTTGGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGG
AGTTCACCGTTGCGAGGACAAAAGGTGAGAGATTTCCCGTGATTTGCCCTGGCCCCATCT
GACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAG
GCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTG
GGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGC
CTGCGTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTG
TTTTCCTGAGACATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACT
TGCTGTATTTGAACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATT
TCCCATGAATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTC
AAGTGAAGGTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGG
TGTGAAGGGCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTT
CCCTGGAGCTCTGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATC
ACTGCTCCTACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTT
GTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCAT
TCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved