Loxodonta_africana Locus Mono:83:SNORD77
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:83:SNORD77
Loxodonta_africana
Mono:83:SNORD77
GeneScaffold_113
SNORD77
1001..1066
2066
ATATACCATGGACTGCCAAAAAAATGAACAAATCTGTCTTGGAAGAAGTAGTCAGAATG
TTCCTTAGAAGCAAGGATGGTGAGCCTGCATCTTACAGACTTTGGACATGTTGTCAGGAG
GGATCAGTCCCTGGAGAAGGACATCATGCTCGGTAAAGTACAGGGTCAGTGGAAGACAGG
GAGACCCTCAACGAGATGGGCTGACACACTGACTGCAACAATGGGTTCAAGCAAAACAAT
CATTATAAGGATGGCGCAGGCAGTGTTTGGTTCTGTGGTACACAGGGTCGCTATGAGTCA
GAACCAAATCAATGGCATCTAACAACAACAGTACCGTTTGATGCCATTTCCTTAATTTGG
GCTAAGGTGCCAACAGTTTTACCCACCATTGCTACTGCGCCATCAGTGAACACAGTGAAA
AAGACAAATCACATCTTAGCATTATTATGAAAATGATTTTGACCATGCAGAGTCCCTGGA
AAAGTCTCATGGACCCTCAAACTACACATTGAGAACCACTGTTTTAGACTGATGGGTCCA
TTTTATCTAAAAAGTAGGAGGCAAGGCCTCGGTACAGGCTTAACATTAGAGTAAAGAGGC
CAGAGAATGGTGAAGAGAGTTAATTAGAGAAAAGCAGAAGTAAGGCAGGCAGGGGGAGGC
CCCAGGGAAGCTGAAAACCATGAATTAACAGTGGTACCAATCTGTAATTTTTTTATACTG
CAATAATGAGAAACTAGGGTTTAGCAGAGAGAAATAAATGAATTAATCTAGAATTGATGG
GTTTCCCTTGGCAGGAAAGGGAGTTGAGGACACAAACCAACAAATCTAAGCTGGAAAAAA
GGGAATTAATTGCAGTAGGAGGCTACAAGATGGGCAGCAGTAGTGGGGCCAAGGGGCTTG
AAGCCTAAGAACAGCTGGAGTAAGAGTAACTCAGGGATAGAGTTAAAAGATGAAAAGACA
TGACGGATCTTACTGGAGCAATGAAAATGTTTTAAAACTGGATTATGGTGATAGTTGCAC
AATTCAGCAGATTTACTAAAAATAGTTGAATTGTGTATAATTAATAAGTGTGAATTTCGT
GGCATGTAAAATATACCTCAAAAAATTGTTTGAAAAAAGTATAGAAAATTGTAGCCAGAA
ATCAAGATGTTTGCATCTAAAATTTCAGAGGTTGGACCACTTCCAGGGCATGGCCAAGAG
AGTCAGTGGTTTAAGAATGCAAGTAAAAATTATGGGAGATGAGCAAGTAGAGGAAGCAAG
AGGTTACACAGTTCTCAAAAGATATGCATAGTGTTTGTTCATTTATCCAACAAATATTTA
CTGACTACTATGTGCCAGACACTATTCTAAGCACTGGGGATTCAAAGAGGACACAGCAGA
TAAAAATCTTTGCCCTTGTGGAGCTTTACATTCTAGTATGCTACCAATTGTGTATGCAAA
TTAAAGAGAATAAAAAAAAATATATATATATGCATGAAAAATAGGACATACACCAAGCTC
TTAAAAAGTGATTACTTCTAGTAAAGAGAGTTAAGATTAGAGGTAAGGTCCAGAATTGTA
CTTCTGCAATATTTTACGTATACATTCCATAGCTAAGACGTACATAGCACTTACAATGCA
CAGGCACTGTTGTGAGTGATCTACAGATACCAACACATTTAATCCTCAGAACAGTGGGTA
CTAACATCAACTCTATTAAAAGGGTGAAAGCTAAGGCACAGAGAAATTAAATAACTTGCC
TAAAGTTAACCAGGTAGTAAGTAGCACAACCAGAATCTGAATGCAGGTGGTCTGGTTTCA
CAGTTGGGGCTCTTATCACTATACTATGTTAAGTATTATAACACAAATGATTTATGTATA
AAGGTACAATAAAAAATAACAAAAATGGAGAAAAATATTCTTTCCTAACTTGTTCTTTTC
CTTCATAGCCTGTATCACAATTTCTTTTATAATTTTTATTGCTCTTTAAGTGAAAGTTTA
CAAATCAAGTCAGTCTCTCACACAAAAACTGATATACACCTTGGTACATACTCCCAATTA
CACTCCCCCTAATGAGACAGCCCGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved