Loxodonta_africana Locus Mono:43:SNORA16
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:43:SNORA16
Loxodonta_africana
Mono:43:SNORA16
scaffold_94811
SNORA16
1001..1143
2143
CCAGGACCCCTCTAAGGTCAGGAAGCCACCTTTTATTTTATTTGTCATTACTAAATGAT
ATATTTCTCCTAATTTCAGAAACTGACTCACCAGGGAATTCATCTTCTTTGTTAACATGG
CATCATCAGGGGCAGTGGGAGAAGAACCTTAAACTTTGTTACTAAGTATTCATATTTGTC
CTGATGAGGACCTGTTGGAGGGAGATGTCGTAATAAGCACCCAACCCTCAAGGCTGTCTG
AAGTCTCTTCCTCATCTGCTCATGTGATGGGACATTTCTAATTCAGCTTCCTGTCTGCTT
CCTTCTCGGCATTTCAGTGGGCTCCTCTCTGTAACGGCACCTGTTTAGGGCCCTTCAGAC
TCTGTTGTTGTTGTTGGGTGCCGATTCCGGCTCATAGTGACCCCATGTGACAGAGTAGAA
CTGCCCCATAGGATTTCCTGGGCTGTAATTTTTAATCTTTACTGTAGCAGATCGCCAGGT
CTTTCTCCCAGGGCGGGTTCCAGCTGCCAACCCTTCGGTTAACAGCCAGCACTTAACCCT
TGTGCCTCCAGGGCTGTAGATGAGTCCAGTAAGAAGTTATTTCTTACCACTCCGAGTGTC
TAAGATGCCCAGGCTCCATGAGACCGAGGACCTACTATGACAAAGAAAAACTGGTCTAAT
TTCTAGTTGTTCCCTCAGCAGGCTCTCTTTTGGATCGTGCCTACAGCTTGGGGAGAAGGG
GATCGTTTTTTATGCGGGGGGAGTCTGGGGAGGGACCTTGCGCTTCCTTCTCCACGTCCC
TCTCCTCAGCAACTTCTGTTCTTGTCATTAGCTGCTGTGGGGTCAGGCCTCCACTCATGA
CGATCCCATGCGCCACGGAACACTGCGTGTCCTGTGCCATCCCCACGATCGGGTTGTGGA
TCAGACTGTTGTGATCCGTAGGGTTTTCACTGACTGATATTTGGAAGTAAATCACCAGGC
CTTTCTTCCAAGGGGCCTCCAGTTGTACCAAAAAAGGGTTAAAAAGTTAGTATCAAAGAT
GCAGCTGCTTTTGCGTTTCTACAGCAGTCAAAAAAAAAAAAAAAGACCCCAAAGTGGCAG
TTGTCGCCTTGGCCACTGTTCTGTGATCTGTAACTGATTTGTGACATTTTGGGAAAAGAC
AGCTAAAAAGCCTTAATATGGAGGGTGGTTGTGCATGTGGTCCCTTCTCGCCCTCTGAGC
AGGACGGACATGACCTACAGGACACACACATGGGGGGACTCTTCCCTGAAGTCCCCTTGG
CCATTCATTGTACCTTGGCAGCATCCGCGAGGCTGGTGGTGATGGAGGTCATCTTAGGCG
GGGTTCTCCAGAGAAGCAAAACCAGTGAAGCGTGTGCGTGTGTGTATGTGTATATATATG
GAGAGAGAGAGAGATTTATTGCAAGGAAATGGCTCATGAGGTTGTAGAGGCTGATGAGTC
CCAAGTCTGGGTCAGGCATGATGCTGTAGGCTTCTCCTGTCTATTTATTTGTATTGTTTT
TATTATTTCTAGATCTACAGGTTGGCCGGCTGTCCTCTGGCTTACGAGCTGTGGAGGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved