Loxodonta_africana Locus Poly:6:SNORD116
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:6:SNORD116
Loxodonta_africana
Poly:6:SNORD116
scaffold_15141
SNORD116, SNORD116
1001..1092, 4821..4914
5914
CTTGTGCTCCAGACAGAATGGTGAGAGCTCTAAATAGTCAGTTGTGTAAGAACTTTTCT
TCAGCGGTGACAGCAGTGAAGCCCAGTGGTTGTGGCCGTGAGTTGCAAGTGATAAGGTCT
TCGAACCTCTGGGAGGGATTTATTACAGACCATTGTTTATCGGAAGTGACAGAGTTAATG
AGACTTGTCTATTGTCCTTGAGATGGGTGGTTTTGTGTAGTTTTAATGAGGCAGCCCATG
GTTTGTGTCAGTTGTGGCCTGTTTGTCATGCAGCTTTGTCACTGGGCTTTCTCACCTGTG
CTTCTTGGAGAACTTGAGGTTTGGTGAGTGGTGCCCCGGAGAGAATGTCTGGCGACCATT
CTACTGAATTTCTGCATTTGGGTCCTGTTTACCTGCAGTCTATATTCTAGTGAATAAGTG
TGTTATTATGTGTCTTCAGAGGGCATTGAAATGATGCATGGGCACAGTGTTGTCAACCAT
GGATGATTGAGTCTCCAGGAGGCATAGAGAACATGATGCCAAAGTATTGTTATATCATGC
CCTTTTCATTGTCCTTTGTGATTTTTACCTGTCTTGTCCTTCTGTATGGACTTCACAGGT
GCCTCTCTTTCCTCTTACATTTTTCAGGTGGAGTTTTTCTGCAGTGAAAGCCAAGTGTAT
TGACGGAAATTCCAGGTTACGTTTCAGTCCAGCAGAGGGGAAGGGATCACTAAACTAATG
GTGGCCTTTCATCTGAATGCAGGCGTTGAATCACCCAGGGCAGGTCAGTATATTTGTGCC
ACACCAGACCGGTATTCTCACGAGGGTTCCATAGGCCCTCAGTGACCTATTTCTTCTCAT
GTCGTTAATGGCATGTGGAGTTTATCCTCTTGGGTAGATTGGCTCCTCCCTTCACTCAGT
GCCTTGACCCCAGAGCTCCATTGCTGATGGTCTTTTGAGTTCTTCAGTTGACCAAAAGGA
CATACCACATCTTGGACAATCCAGAGGCTATGAATGTGCTTGGATCGTTTATGACTTCCA
CACATACATTCCTTGGAAATCTGAACAAAATGAGTGAGAAACCCCTACTGTCTCTCTTAG
CAACCTGAGGTCCAGCATACCATCTGATTCTGGCCAATACAGGAGTCAAGGACAGCATCC
AGTGGCTCCTCCTCGTGGCCCCACATTAGACCAGAACTTCTTGAAGTGCCCAGATTTGTG
CACAGGGCAGAATCCAGCTGTACAGACCTCACTGGGTAGCAGCTTCCCTGGCAGGTTGGG
CTACACTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATCACCCAGTTCAGGTCAG
TATATTTGTGCCATAACAGACTGGTATTTCACTAGGTTTACATTGGACTGAAGTGATCTA
TTTCTCCTCGTGTCATTAAGGGCATGTGGAGTTTTCACCTTTTGAGTGGATTGTCTCTGT
TTGCTCAGTGCCTGGGCCCCAGAGCTCCAAGTTGCTTGCGGACATTTGAGTTCTTCGGTT
GCAGTTATTCAAGTTTAGGATAATCTTGGCTTTTCTCCTTTTGGCTCTGGGATTGTACGC
TGCAAGGAATTGGAATTTGAAGTTAGACTGAAAGGTGGTTGTGTGGCCTGCATGGAGGTG
ATACCTCTGTATGGTGAGGTGAGTGGTGAAGTGTCCGGTACTGCCACAACATTGAAGCTC
AAAGAATGTGGGAACGGGCCCAATTCCCTAATGGAGACTTGAGCCCCCAATATTGTGCCT
GCCCGTTGAGCTCTCAGCTGAGGATTGCACTGGGGCCTAGGTAGGGAATTTTTATTAGTT
ATGATGAGCAAGTGGCAGATTTGAGTCAGTGTTGACCTTGTAAGCCTGGCAGCTTCTGCT
GCTTATCTTATTTGCTAGAGGTGCTGCATTTTATCGAAGTATATTTATTCGCAGGTGCTC
GTCAGTGTCTGTCCAGGGGCAGTTCAGTTCTGATGTCTTCCAAAGCTATAACATAGGTGT
CACTGTCAAACTCATTTTCAGGTTGAAGGCTGAGAAAGATGCAGGGTACTTTCAAAGAAA
GCCATTTATCCAGGGCACAGGGCACTTTTTAATATCCACAAGTGGTCAAGACGGGTACAT
TCATGTAGCAGCTCATTGCCCTTCAGGTGTATGCGTGCTGAGTTTTGGACCCGATGATTG
TCCCCAGCGGATCTTTGTTAATGTGTTATGTAGCTCTCTAAATACATGCATGTGCACAAG
CACACATACATATGTATATGATGTCACTCAAAGAAACATGCATGCTTCCATCCATATTCA
GTCAATGAGACATAGCTGCAGGCTGTCCCACTGGAAATCCAATGGCCTTGTGGTTGTTGC
CTGTGTTGTACCTGCACATGGATCTCATGAATTCCTCTCTTTCCTTTTACGTTTTCCAGA
TGGAGTTTTTCTGGAATGAAAGCCGAGTGGATTGAAGGAATTCCAGGTTGCATTTCAGTC
TCCCAGAGGGGAGAGATTCTCTGGACTAATGGAGGCGTTGGTTTCCGAAAGGCATCCGTT
GGGTCGCACAGGGCAGGTTAGTATATTTGTTCCACAACAGATCAGTATTCTCACTAGGAT
TCCATAGGCCTGAAGTGACATATTTCTTCTCATGTCATCAATGGCCCCGTGCAGTTTCAC
CTCTTGGAAGTGGATTGGCTCTTTTTGTTCTCTCAGTGCCTTGGCCTTGGGAGTTCCATA
TTGGATCGTGGTCTTTTGAGTCCTTGGCTGAACAAAAGGACAGACTACACCTTGAGCAAT
CCAGTAGTTATGAATGTTTTGGAATTGACGATGACTTCTACATGTACATTCCTTGGGGAA
TCTGAATCAAAACTAGTGAAAAACCTGTATTGTCTAGCTCATTGACCTGTGGTCCAGTAC
ATTGATTCTGGCTAACACATGAGTGAGGAACAACATCCATTGGCTCCCTTTCGTGGCCCC
ACACTCCTCCAGTACTTCTGGAAGTGCCCAGATTTGCGCACAGGGCGATATCCAGTCCTA
TAGATCTTTTGGGTACCAGATTCCCTGGTGGTTGGCCCACTTGGGGAAGCTAGGCAACAC
CAGGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved