Loxodonta_africana Locus Mono:1:SNORD62
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:1:SNORD62
Loxodonta_africana
Mono:1:SNORD62
scaffold_3518
SNORD62
1001..1086
2086
TGCCCGGGTATGCTGGACCTGGCTGTTGGCTTCCCTGGTGCTATGGATGAATCTGCCAG
GCTCCCATAGGCCAGGCTCTGCTTACGCTGCTGGGGTGGGCTTTTTGCCTGTGCCGGGCT
TTGCTCCAGCTCGTCTCCCTGTCTTTCTTGCCTGTCTGCATGCATACTTGCTACTATGTT
ACTCTCTTGGTGTGGGGACCTCCTTTGACTACATTTCCTGCCATCTTTCCCCTGAAGGTT
TTTTTCAAGGACACGAAAAAATTCCATGTTACTAAATCCCATGCTTTATTCTTAATCCTC
CTTCTCCTGCCCCATCAGCAGCATCTGACAAAGCAGTCACGCCTTCCACCTGAGTCTTGT
TCTTCATGATTTTGAGCCTCTTTCTTCTGGGTTTTCTCCCTGAAATCCCTCTTCCTTAGC
CTTCTCTGCTGTTTCACCTCACTTCCCCAGTCTCAAATGATTGGCGTGCACAGGGCTCAG
TTCTGGGGCCTCTTCTGGGTAACCTTGTCCCTGTGGCTCTAAGTATCATCTGTGTTCCAG
CTACTCCCACATTTATGGCTCCAGCCCAGATCTGTCTCCTGTACTTGAATCTCATGTTTA
ACTGACTACTTGGTATCTCTGCTTTGATATCTGTGGCATCATGCGCTTAGCCACGTGATT
TCCCCCTGGTCCTTCTGGTTGTCCAGTCCGTGTTATCCTTGGCTCCTACTACCCCCACAC
TCCCATCTGGTCCGTCAACAAATCCTGCCAGCTGCACCTTGAAATGTACTCAGAATCCAA
CCATTTCTCGTCACCTCCTTCCCGCCTTCCTGTCCAAGCTACTACAGGTGCTCCTGCCTC
TGCTCTTGGGCCCTCACAGTCTGTCCTCAGCACAGCACCTAGGGCGTTCCCTGTAAAACA
TAAGTCAGGTCATGCCACATGCCAAGTCAGGCTCTAAAAATAGTAGTATTGTCCTCTTCA
TCCCACGTCCCGTTGGAACTCCAAGGAGGAGGCGCCACAGATCTCAATGATGTAATTCCA
ATAGATTCTTCTGACTCTCCACTGTGGGCTCAATAGCAGGGAGATGAAGAGGAGAGTGAC
TGAGAGACTGAGGCGGTCCTCACTTATCAGAAAGCCCGCCCACCCTGGTCCTGAGAGTGT
CCCAGGCCGTCTCCCTCTCCTCTCACCTACCATGTTCTGGACTTTAGAAGTGGTTCTGCA
GTCACCTCCCATCCTGTGATAGCCTGCTTCAGAAGGATTCCCGAGGCCCCGATTTGAACC
CTCAATCCAGACTCTTGTTTTCTAACATGAGTGGATGCAAAACAGTAAAGGAGTTTTGCT
TCTTTGTTTGTTTGTTTTTATGAGGGATACAAAGATAAACTTTCTATGTAACTTTCGTTT
TTTAGGACTTGGCTTCGACGTTACTTCCTAGGAAGCTTTCCTAACTCCCCCTCCCGCTCC
CTTTCTCCCTCCCAAACACACACACAGTTGACACTCTGCATTTCACACACCAGCACCATT
GCCTCTTCCCATGTCTGGCTGCCCTGCCTCTTCTCCAGCACACTGTGTTCTAACAGTGAC
TGCAGGATCTAACAGTAAACGTTTGTTAGATGAAGGCAAGAAGGACTGAAGATCATGCAG
CCCTTTGCAGACTCATAGAGGAGGCACATACTTATGCTGTTAACTCTTTAATGTGTGGTA
CATGCTCTCTAGAACTACTTTAGCCTTGCAGTTATTTTCTCACCAGTGAGCCTTGCCACT
GCTATTAAGAGTGCACAGTCTAGGATAACATCTCCTGTGCTGTCAAAGAAGTACAGAACC
TTCAGTGCTGTGCACGGGTCTCGCTTTAATTTTTAAAAAATAAGATCCAAAGCTACTTAT
TTAAAAATAAGAATGTGGTAGCCCTTGGATGCGTATATAAGCAATGGTTTGTGCTTTCTC
CTCAACATCCTTCTTCCTTGTGACTGTCCTGTCATCAGCAGTTGACATGCGCTGCCTGGC
TCCCAGCTGCCTCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved