Loxodonta_africana Locus Mono:81:SNORA13
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:81:SNORA13
Loxodonta_africana
Mono:81:SNORA13
GeneScaffold_2865
SNORA13
1001..1134
2134
CATGGGGTCCTTCTTCCTAGCCTGTCTTAGTCTGGAAGCTCAGCTGAGACCTGTCCACC
ATGGGTGACCCTGCTGGTATTTGAATACCGGTGGCATAGCTTCNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCGAATGGCGGTGCGACCCCGGG
CGCGAGGCAGCGTGGCTGCCGACAACGGCGGCTCGGGACAGGAGCGCGCGGCCGCCCTGA
GCCTGGTGAGGCGGCCCGGCCCAGAACACGAGAAGGACAGCGCCCTGGGTTTTCTCGGCC
GCGTGCTCCATATGATCTCTGGAGGCCCGGGGCCGGTCTCCAGACTGCGTTTCCTTACCC
GGAAAATGGGGACGTTCGTTTCCTGTGCTTTAAGTTAACTGATCATCGACTGCATGCCAG
GGAGTTTTTAATATAAGCAGGGATGTTTTCGTGAATGAGAAGGGCCTTACTCCAGTGTAA
AATCAGTTACTGTAGAAGTAAAATGTACCATTTAGGGTTTAGATCATTACGGCTTCCTAC
CATAGGTGCGGAACTTAACCGACAGTGAATGAGTTATCGTGGAATTCAGGTGAGTTCTTT
TTAATGCAAAAAACAGAACGTAGTAGTCTGGGAGGGGGTAAGCCAATCTTTACTACTATA
TTGAAAACACGTGGTATTTCAGTGTCCCTTACCAGATCGGGTTTTGAAACTCAAAACTGA
GTTAATTGTTCTCTCTCATACAGAAAGTTAACGTCAACCATTTGATTTAGGGTCAGCAAC
TCTGTGCCATAGATAACGAATTTCAAGGCAGTTTCCATGCAAGCCTTTGTGTTGCCCGTT
CACTTTCGGAAACTAGTGAATGTGGTGTCAAAAAAGGCGTAAATTAAACCCTTTGCAGCC
ATTTTCTGCCCTTGAATTTGATTTCTTTGGTGTAGGAGCTGCGTAAGTTACAGTTCATTC
CTTTACAATCATTGTTTACACACCTGAATTTTAGTCTGCCAAAGTTAATGTATGTTTTCT
CTTAACTAGTTTTAACTGATACTTGTTTAGGAGGAAAATGGATGTTTGGAAACGGCTGCT
GCTAATACCATTTGCACAAAAATGACTTAAGGTATGGTGACATTGTTGAAGTAGAAATTG
TTCTGTCAAATAGTTAATTGTGATAAGGATTCTACCACATTTCTAAACTGGGAGGCTTCT
AATTGGTATTGGTTTAAATTAGGTGTTAATAGCACATAGTTATCGTTAATACTGCTGCAT
CTGTAGAGTTCAAGGTTAAGTTAAACAGCAAATAGGACAGCCTCTTGCCAGCTTAATCTT
TGCCAACTAAAGGTTTTGCTGTTTTTTCTGGGTAGTCTGGAGAAACAATATATAGTACTG
GGGTTCAGGATGTACCAAATGTAAATATTTGCTTGCCATATTAAATGCTTTTATTTTTTC
TCTCTTAGGATGACCTTTGTGGTGATTTTGAGTTTTTGATCTTCAGAGAAGTTACTTGGA
TCATACAAAATTTCAGGAATCTGAGGAGTACTGAAATAATTGCCTTTGGACAGCCCATAA
TTAGGTGTTTAAAGCAATGGGGAATAAAAATAGTTTACTGTGCTTCTTGGGGGTTTGCGT
TTTGAGTGATTAACTGTCAGAAAATAACATTTTTTTACCAAATCATTAGAGGTTTGTTTC
CACCTCTAGAGCCGCTCAAAGGAAAAATATAGTCAAGTATAGGGATCTATTTTAATTGAT
TATTCTGCCACGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved