Loxodonta_africana Locus Poly:20:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:20:SNORD115
Loxodonta_africana
Poly:20:SNORD115
scaffold_72701
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2810..2887, 4506..4586, 6213..6293, 7914..7994
8335
CTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGC
ATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCA
CTTTCAGGTTGATGCCACAGGAGGTCATGTTTTCCCTGGAGCTCTAGACAGTGAAAGCAG
GCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATC
CTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCTAGGAATCCTCTGATGGTTGAT
AAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTG
TGTCTCTTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTTTGG
GGCAAATTCCTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAG
TTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGG
ACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCT
TGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCT
GGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTG
TCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAA
TGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGA
AGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGT
GCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACT
TGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCAGGGTCAACGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGC
CCAGAGAGAAACTCCTTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTT
GGGATCCCTTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCAT
GCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGA
TTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGA
CACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGAC
GTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGT
GGATAGTTAGGAAGCACAGGAAGCCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTC
CCGGGTCCCCAGTCGGGTATGTCTACGGAATTTGAGAATATTTTCCAATTCTCCACTTTT
TTACCGGATGGGGAATGTGGAAAAACTCCTCCGGAAAAAACAGAGAAAACTTTGCCCTAA
TTAAAAGCCCTGTGTTAATTTGCGAATGGACTCTTAAGATCCCCCAGGGGCCCTCTTACC
CCAACATTTTGGGTATTGGAAGAAGAATGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCTGGGTCCTCCTGAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTC
TGAATATTGCGTGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAA
ATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGG
GAAATGAGTTTCTCTTCTGGGTATCTCTGTCTTACCCACTTCCCCTTTTCAAAGGGTTAG
TGAGGTCGATGTGTCTTGTCCTGCTTTCACGGGGGTCAAGCCAACTGCCCGGGAAACTGG
AAGATGATGTGGGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTG
GTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGA
TGACATAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGC
TGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCC
CATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGT
CAGGCTGATTCCTTGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAG
GAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATC
TGACACTTAGGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGA
GGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGT
GGGTGGATACTTAGGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAG
CCTGCGTCCAAGTCCGATACGGCCTACTGAAATGGGAGAATCGGCCAACTAGAAAAATGT
GTTTTCCTGAGACATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAAC
TTGCTGTAATTGAAAGCGTGTGTCAGTTGCGACTGGACTCGCAGGATTTGCGGGGCGCTT
TTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTT
CAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAG
GTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTT
TCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGAT
CAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTT
TGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCA
TTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAAC
TCTGGAAATGCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGT
CCCACAGCTCATTTGAAAATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGT
GCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGG
GGCTGATGAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGAGTACTTTTCTCCATTCG
GAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAG
TCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGG
AAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGC
CCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTA
CTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGG
ATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGA
TGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATC
ATGCTCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGAT
CTGCTTTAGAAGGGACCCCCATTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTC
CTCCCTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTT
CGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGC
GGTTTTCCCGTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTC
GGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACC
AAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCC
ACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAAT
ATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCA
GAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCCAG
GGCCTCTTTCCCAGACATCTTGGTATATGGAGTGAAGACTGGAGTAGCCTGACACCTCGC
TGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAGCTAATGCCAGGCT
CAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGGTTCATACCACAGG
AGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTGCTGCCTTCCACAT
GTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCT
TTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGGAGATGTGTTCCCTC
TCTGGGGATTATTGGGGCCTGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTCAAACCAACCATGCCCCGGAAAACTGAAAAGTTGAATGTGTGACGCCTCTCAT
CCCCACTTCCTTTCCTGGGAGGAAGGAAGGACATTTGGTGGTAAGGCCTCTTCCAGGTCT
CAAGGGATTTTTCCTAGGGAAGTGATATGGCTGGGGTCAAATGATGACATTAATCTGGTC
TGGAAGAGAGATGATGACCTTAAAATCATGCTCAGAGAGGTTATGCTGAGACCCTGTGGG
AAAGTCCTTTGGCCCAGCCTTCCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCT
TTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCT
TGGCTCCTTTCCTCTTTTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTG
CGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCA
AGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTCCCCTG
GTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTA
GGAATCAGAGAATCCTGAAACCTGTGTGCTGGAGTCATCTTCGATAGCCTGCGTCCAAGT
CCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGTGTTTTCCTGAGAC
ATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTATTTGA
ACGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCATTTCCCATGAATCT
TGAAACTGGATGAGCGACTCAGTAGTCCGAAAGCTGGCTCCAGCTTTCAAGTGAAGGTAG
CTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGCAC
ACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAGCTCT
GGACAGTGAAAGCAGGCATAAGTGCTGCCTTGCACATGTGCAAAGATCACTGCTCCTACA
GAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAAT
CCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATG
AGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCT
AGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATT
TGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGA
TCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATG
AATAGCCTGTTCTTCGGCTGGGACTTCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATG
CCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGG
GCGAGAAGTGTGTGTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGC
TGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAG
GATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAA
CCGGAAGAGGACGTGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATC
GGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCA
ACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGG
ATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGG
GGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGA
TTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGC
TTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTG
TCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAA
AAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved