Loxodonta_africana Locus Mono:26:SNORA42
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:26:SNORA42
Loxodonta_africana
Mono:26:SNORA42
scaffold_46573
SNORA42
1001..1132
2132
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGCTATCCCTTTCAGTTCT
CTCTAATTACAATTTAGAATAATGTTTCTGAGCCACCTGGGAAATGCATTCTGCTTTCTG
GCTCTGAGTGGCCCAGGAATAAATCTCATACCCCTTTACCCCCAACCTGCTCAGTAGGGG
CTCAGCAGAAGGAAGGGGAAAGCTATAGCAGAAGCAACTCAGCCTCCCAAGGTAGATACT
CTGTGGGCCAATGATATTATTGGCATTTATACCATTCTACATTTGCATAGGTGATCTAGG
TGGGTTATCATCTGGCTGATGTGTCTCCAGAGTAAGTCTGGGGGAGGAGTCTGTGATCGT
TGGGCAGGTTTGGATCACTCACTAAGCAGCTTGTAGAACATCTAGAGAGGAATAATTCCA
AAGCACGTTCACATCTGTTGGCTCACTTCATTTTAACGAGCCTGTCTTGTCTTTGATATT
TGCATGGCATTCATTTTTGCTTTTCTCATTTCTTCCAGAAAACGCCCACTCCTGGATCTT
CACATTGAACTCCACAGCAAAGTCTATGATTGGAACAGTAGAGTTTCTGCTAAGGAGAAG
TACTCCGTTTGGCTGCAGCACACACTGAGAAAGAAACTCATCCTTTCTTGCAAATGAAAA
GTCAAGAGCCATTTTAGCCCTACAGTCTCCATCACTAGAGGGAGGGTTTTCAAGCAAGTG
TGTATGTGTGTGATGTGGGTGAGGTAAGGTCCCATCCCGTCCTGAAATGACCCTCTGTGA
GGACCGCTTGACTAGAAGGGGTGTTTGAAGTATAGATCCTGAAATCAAGGTGTTGATCTC
TATTCTGGTTCTTATTTAACTAAAACAGCATATTGCTCTTAATTTGGGGCTTGGATCCTC
ACTACTTTTTGAAAGCAGCTTACCAGAATGTTGTGAGTAGAGCACAGTAATGGACTTATA
GCAAGCTTTTCACCGTACCCATAGTGTATCCATGCCAGAGTAAACTGCATCCTGGAACCA
CTGCCCAGCCTCCTTACCCAGAGGCTGTGAACACTGCAGGGGGTTACAGAGTGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved