Loxodonta_africana Locus Poly:13:SNORD88
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:13:SNORD88
Loxodonta_africana
Poly:13:SNORD88
scaffold_39875
SNORD88, SNORD88
1001..1091, 2680..2769
3020
TGGAATCTGCAAAACTAGGCACTGGGGACACTGGGGTCCTCTTCATGTCATGGGTTTGG
AGGCTCATCCTCTGAGGACAGTCCCCCCTCCATCTTCCCTGGACTGTGATGGTGGGTTTG
CAGTGGGGGGAGACATTGGTGTCCCTATGGGGAGAGCTGTGGTGATTTAAACCCTTCTTG
ACAGACTCGGCTCTGGTAACTCGGCCTCTGTCCCAAAGGTGAGAGGCCTTGGGAAATGGC
TGCAGAGGTCCGGGGCCCCCATGATGTCCAGCACTGGGCTCTGATCACCCCTGAGGACAC
AGTGCCCCCCAGGACCTTTGACACCTGGGGAACTGAGGGGCCCTGGCCCTGGGAAAAGTT
TTAATGGGCTCCTGGCCCATTTCTTGCCTCCTCACCAAGTCCTTCCTTTGTTACAGGTAC
ATGTTGAACCTGAGCAGCCATCCAGCCACTCCTGTCTCAGTAAGAAGCCTCACTCCCACC
TGTCCTGCCCAGGCCTTCGGGCAACTTTGTATCAAGTATCTCTAGCATCTAATTCATGTG
TCAACAATCATATTCAGGACATAGGTATGTAAACAGTCTTGTTATAGCTTTGGAAACCCA
GTCACACGGACCTGGGTCCAAATCCCACGTCGTCTCTTTATGGGCTTGGAGGTGATCAAA
TGATTGCTGTCCTGAGCTTCAGTGTCTTTATTTGCAGAAGGGGCAGGCTTCATAGGAGCA
GATAGGCTACAGCTCTCTCTCCAGTGGGGTGGGAGTTGGGGGATAGTGATGTTACTTGCC
TTGCAAAGATAAGGATTGAATAAGGTGACGAATACCTGTGCTATGAAAAAAACGTTTTAA
GGCATTTGGTGGTATTTAGGTTTCAGGTAGGAGCCCTGGTGGCACAAATGGTTAAGTGCT
CAGCTGCTGACCCACCCAGTGGCTCCTTGGGAGAAAGACCTGGCTATCTGTTCGTGTAAA
GATTGTTATGGGACAGTTCTGCTCTGTCCTGTAGGATCACTGTGAGTCGGAACTCAGCGG
TAGCTAACGACAACAACATCCGTAATTTACCCAGTAGCCATTGTTAAGATAGCACAGTTT
TTCTAGAGAATGTTTCTATCATGTTTCAAAGAGCTATGTTATAAAAGGCATATATTGTGT
TATTGGGACAGAAGCAAGTTTTTTCAGCACAAGGAGGATTTTTATCTGTGTCCTGGAGTG
TTGGGGAGTGGGGGACAGTGGCTTCAGTGAAATGCATCTAAATATGTCTCCCCCGAGAAG
TGCTGGTGGCATGGTGCTTAAGCACTCGGCTGCTAACCCAAAGGTCAGCAGTTCAAACCT
ACCAGACACTCTGCAGGAGAAAGATGGGACAGTCTGTTTCCATAGACATTACAGCGTTGA
AAAGCCTATGAGGCGGTTCTGCCTTGTCCTATGCGGTCACTGTGAGTCAGAATCAAAGTG
GCAGTGGGTTTGGTTGGGTTTGTTTTTCCGTTTTCTTGCTGGCAGCTACCTGCCTTATTG
CCTATTGATCTTGGGATTCATTGGCCTCCACAGCCTGCTCTCTGACCTACTGATCTTGGA
TTTGTCAGCCCCTGCAGTTACGTGAGTCAGGTAAAGCCTCCATCCTGACGCCTGACCCAC
AGACTTTGGACTTGCCAGCCTCTACAGCTGTGTGAGTCATTTTCTTGAGATAAATCTTCC
TCTTTTCGTTTCTGTCAATCTATCTATATGTAAATACACGCTGTCCTGGTTTTGCTTTTC
TAGAGAACCCAGCCTAAGACAGCGTTAGAGGCCAGGCATGGTGCTGGGGAGGGGGCTGCC
TCGTGGTACCCCGGAGGCCATGTGTTGGTCATCTTTCCTGCCTGAGCTTTTGAGATCTCA
ACTGTGCTGTCCCTCACAGGACTACAGGCAAGTAGCTCTGGGCTCAGTTGAGGGAGGGGG
GCGAGGGCACTGGGGCTCGATGATGTCCAGCACTGGGCTCTGACTGACCCTGAGGACACT
GTGCCCCCAGGACCTTTGACACTCGGGGGTCTGAGGGCTGCAGACTTGGGGAAGGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved