Loxodonta_africana Locus Mono:35:SNORA7
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:35:SNORA7
Loxodonta_africana
Mono:35:SNORA7
scaffold_1658
SNORA7
1001..1138
2138
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAG
AGTAAAAATCCCATAGAATTTCCAAGGCTGTAATCTTTGTGGAAGTAGACTACCACGTTT
TTTTTTTACACAGAGCTGCTGGTGGGCTCAAACCACAGTCCTTTTGATTAGCAGTCAAGC
ACTTAACTACTGCACCACTAGGCCCACATACCAAAAAAAAGTAAAAAAACTTTACCAAAG
TGCCTGATAAATTGTCAGTCTCATTAGCTGACTTCAGGCTTTCATCATCTTGTATATCAT
TCCTATTGCACTATTACTCAAATCCATTGCTCCACATTTTACTCAAAACCTAAAGATCTT
CATAATAAGTGAATAAAAACATCAGAAAAGAAACGTGTATAGACCTCCCAGGACCTTGTC
TGAAGAGTGGCTAAAATTCCATCAGCTTCAGAGATGAGAGGGAAAGCAAGCCTGTCAGAG
GCCCGTTTCATTCCCAGCTTGCTCAGTAGGTGGTGACTGGAAGATGCACTGTGACAATGT
TCAAGTCCTGAGCGGAAGTCCTGGTGCCAGGACTCTGCTCTGACATGGGTTTATCTCTTT
TTTGAAGGCATCATGGCTGCCCTCAGACCTGCAGTGAAGCTCAACATCTTCAAAAAGAAG
ACCAAGAAGTTCATCTGGCACCAATCAGACCACTGTGTCAAAATTAAGCACAACTGGTGC
AAACCAGGAGACACTGACAACAGGGTGTGGAGAAAATTCAAGGACCAGATTTTGATGCCC
AACATTGGTTACAGGAGCAACAAGAAAATGAAACACATGCTGCTCAGTGGCTTCTGCAGG
TTCCTGGTCCACAGTGTCAAGGAGCTGGAAGTGCTGCTGATGTGCAACAAATCTTACTGT
GCTGAGATTGTGCACAGCATTTCCTCCAAGAACCGCAAAACCATGATAGAAAGAGCCGCG
CAGCTGGCCATCAGAGTCACCAATCCCAATGCCAGGCTGCACAGAGAAGAAAATGAATAG
ATCGCTCATATGCAAGTTGTGTTTGTGCTAAGTAAAACCATAAACACTCAAAAAAAAAAA
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved