Loxodonta_africana Locus Poly:23:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:23:SNORD115
Loxodonta_africana
Poly:23:SNORD115
scaffold_2024
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1078, 2726..2806, 4425..4502, 6120..6200, 7819..7896, 9522..9602, 11256..11333, 12953..13033, 14632..14709, 16396..16475, 18079..18156
19156
CTGATACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCAGAGTCAAAAAG
CTAATGGCAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGG
TTCATGCCACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTG
CTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATT
CCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGA
GATGTGATCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCAT
GGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGA
ATTCTTGGAAAGCTATTCTTTTCTAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGC
TGGGGACTCTTGGGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACA
CATACTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATTGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAATATT
GCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTTGCGAATGTCTGGCTGAAGCATAGCCTTAGGGAAATGAGT
TTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGAT
GTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACGGGAAGACGACTG
TGTGAACCCTCTCATCCACTGTCCTTCCTGCGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCCCGCCTTACCGATCTTCTTTAGAGCGGACTCCCCATTTTG
ATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTG
ATTCCTTGGCTCTTTTCCTCTGTTTTGTGTCCTTTAGACACAAACCTGCCTCCGAGGAGT
TCACCGTTGCGAGGACAAGAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGAC
ACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGGCAAAGCCTGAGGC
ATGTCCCCTGGTGTGTGCTTTGACTTTGCCTGGTTGACTAAGATGGCGGTGATGTGCGTG
GGGTTGGATACTTAGGAATCAGAGAATCCTGAAAAATGTGTCGCTGGGGGTCATCTTCGC
ATAGCCTCGGGTCCAAGTCCGATACGGCCTAACTGAAATGGGAAGAAGCGGCCAACTAGA
AAAATGGATTTTCCTGAGATATTTATGAGATGTGAATGGCTCATGAGCTCTACAGGAGAC
CGGTTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGC
AGGGCGCTTTTCCTCATGAATCTTGAAATTGGGATGAGCGACTCAGTAGTCTGATAGCTG
GCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCGTAGAAAATCTAAAGTCAGG
GTCGATGCCAGGTGTGAAGGGGACACGACGGGTCAGGAGCACTTTCAGGTTGATGCCACA
GGAGGTCATGTTTTCCCTGGAGCTCTAGACAGTGAAAGGCAGGCGTAAGTGCTGCCTTGC
ACATGTGCAAAGATCACTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAG
ACTCCTGCTCTCTTTGGGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGT
TCCCTGTGTTGCCATTCTTGGGGAATGAGGTGGCCTGGAGTGTGTCTCTCCATGGCACAA
AGTTGAAATCAAACTCTGGAAATGCCTAGTGGAATTTGGGGCCAAATTCTTGGTGAAAGC
ACTCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNATAGGGACAAAATCAAGACACACACTTCTGGCCCGTTAGTGAGACTGCTGACCC
TTGACAGAAAGGCCGACACGTGCCCTATCGGGACAAGGGGGTGAGTGTTGATATTGTCCC
AATATTGGGCTATATGTGGAAAAAGCATAGGCTTTTCATTTGAATGTCTCTCGTCAGATG
TCTGACTTACTTCTTTAGCCTTCGCTGCACGATAGGGTGGTCGATGCTTTTCTTGATGAG
CTTTCCTGAGGGTCAAGCTACTCCCCGGGACACCGGAAGAGGATGTGCGAACCTTCTCCT
CCTGCGTGATTGCGGGCTGGAAGGATGATGTCAGTGGTGAGGACCTTGAGGACTCAGGTG
ATTTTTCCCGGGGTTTGAGATGTCTCGGGTCAATGAAGACACCTCAACTTGTCTCGAAGA
GAGATGATGACATAAAAATCATGCACAATAGGATCACGCTGAGGTCCAGAGAGAAACTCC
TTTTCCCCAACGTTAATGATCTCCTTTAGAGTGGATCCCCGTTTTGATCCCTTTTTCCAT
CACCAAGTGATCAGAAACTCCTCCCTGACCGATTTTTGTCATGCTGATTCCTTGGCTCTT
TTCCTCTTTGTCTGTGATTTAGAAAGACCTGCTTTCAAGAGGTTCACCACCGGAAGAACT
CAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCCCTGGGGATACCTAGACAAGTGAATA
TGGAGCCCAAGAGGCAGTCGGGTTTTGTGAAAAGGCTGAGACGTGTCCCCTGCCTTGAGC
TTGACCTGACCGATTGACCAAGGGGTGGTGATATGCACGGGTGGATAGTTAGGAAGCACA
GGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGATAGTCCGGTTCCCAGTCGGGTATG
TCTACGGAATTTTGAGAATATTTTCAACTCTCAACTATTTACGCGATGGGAGTGTCTAGC
AGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTGGCGACT
GGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGGTGAAGAACTGA
GTAGCCTGACACCTCGTTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATTTGAGTCAG
AAAGCTAATGTCAGGTTCAATACCATTCGGTAAGTGGGTCGCGAGCGTCACGACTAGTTT
CAGGTTCATGCCACAGGAGGTCAGGATCTGCTGAGAGTCTAATCAGGAAATGCAGGCATA
ACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGA
GATTCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACAGG
AGGAGATGTATTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGCGTCTCT
CCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGG
CAGAATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGGCCCCCCG
GTACTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACGCTGGACAGTGCCCGTG
GATGCATATTTGGCTGCCTTCAACACCTCAGTCAGGCTTAATCAATTGCAAAGTCTCCTT
TTGCCTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTGTTCTGAA
TACTGCATGATTTTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGG
CTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAA
TGAGTTTCTCTCCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGG
TCGATGTCTCTTGTCCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACGGGAAGAC
GATGTGTGAACCCTCTCATCCACTGTCCTTCCTGCGTGGAAGGAAGACATTTGTGGTAAG
CATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACA
TAATCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGG
CCCTGTGGGAAAGTCCTTTGGCCCCGCCTTACCGATCTTCTTTAGAGCGGACTCCCATTT
TGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGC
TGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTT
CACCGTTGCGAGGACAAGAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACA
CTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTGGCAAAGCTGAGGCAT
GTCCCCTGGTGTGTGCTTGACTTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTG
GATACTTAGGAATCAGAGAATCCTGAAAAATGTGCGCTGGGGTCATCTTCGATAGCCTGG
GTCCAAGTCCGATACGGCCTACTGAAAGGGGAGAATCGGCCAACTAGAAAAATGGATTTT
CCTGAGATATTTATGAGATGTGAATGGCTCAGAGCTCTACAGGAGACCGGTCAACTTGCT
GTAATTGAAAGCGTGTGTCAGTTGCGGTTGGACTCGTAGGATTTGCAGGGCGCTTTTCCC
ATGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGT
AAAGGTAGCTGCACAGATAACTGCGTAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTG
AAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCT
GGAGCTCTAGACAGTGAAAGCAGGCCTAAGTGCTGCCTTGCACATGTGCAAAGATCACTG
TTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGC
CAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTGCCATTCTT
TGGGAATGAGGTGGCCTGGAGTGTGTCTCTCCATGGCACAAGGTTGAAATCAAACTCTGG
AAATGCTTAGTGGAATTTGGGGCCAAATTCTTGGTGAAAGCACTCTTCCGAGTGTCCCAC
AGCTCCTTTGAAGATCCCCAGTTTTGGGAACCCGTGGATGTCATTTCCTGGAAGTGCTCG
GCACGGATCCGTGCGTGGGGACACAGATTTGGCTTCCTTGTAGACATTAGCCGGGGCTGA
TCAAATGAAAAGCCTGTTCTTGGCTGGGACTGCCTGAGTATTTTTCTCCATTCGGAGCCC
TCTACGCCTTGTCTTGATCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCAC
TAACGGGCCAGAAGTGTGTGTCTTGATTTTGTCCCTATTTTGGGCTATATGTGGAAAAAG
CATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCC
TAAAAGGATTGCAAGGTCGAAGCCTGTTTTACTGCTTTCATGGGGGTCAAGCTACTCCCC
GGGACACCGGAAGAGGATGTGCGAACCTTCTCCTCCTGCGTGATTGCGGGCTGGAAGGAC
GATGTCAGTGGTGAGGACCTTGAGGACTCAGGTGATTTTTCCCGGGGTTTGAGATGTCTC
GGGTCAATGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCAC
AATAGGATCACGCTGAGGCCCAGAGAGAAACTCCTTTTCCCCAACGTTAATGATCTCCTT
TAGAGTGGACCCCCGTTTTGATCCCTTTTTCCATCACCAAGTCATCAGAAACTCCTCCCT
GACCGATTTTTGTCATGCTGATTCCTTGGCTCTTTTCCTCTTTGTCTGTGATTTAGAAAG
ACCTGCTTTCAAGAGGTTGACCACCGGAAGAACTCAAGGTGAGTGAATGACGGCGGTTTT
CCCTTGTCCCTGGGGATACCTAGACAAGTGAATATGGAGCCCAAGAGGCAGTCGGGTTTT
GTGGAAAGGCTGAGACGTGTCCCCTGCCTTGAGCTTGACCTGACCGATTGACCAAGGGGC
GGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAG
TAATTTTTGATAGTCCGGTTCCCAGTCGGGTATGTCTACGGAATTTTGAGAATATTTTCA
ACTCTCAACTATTTACGCGATGGGAGTGTCTAGCAGCTCTACTGGAGAAACCAGAGAGAC
TTGCCCTAGTTGAAAGCCTGTGTCAGTGGCGACTGGACTCTTAGGATCTCCAGGGCCTCT
TTCCCAGACATCTTGGTATTGGGTGAAGAACTGAGTAGCCTGACACCTCGTTGTAGCATT
CAAGAAAAGGCAGCAGCACCAATATTTGAGTCAGAAAGCTAATGTCAGGTTCAATACCAT
TCGGTAAGTGGGTCGCGAGCGTCACGACTAGTTTCAGGTTCATGCCACAGGAGGTCAGGA
TCTGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGA
TCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGTGT
GCCCCACGGGATCCTCTGATGCTTGATATACAGGAGGAGATGTATTCCCTCTCTGGGGAT
TATTGGGGCCTGAGGTAGATTCGATTGCGTCTCTCCATGGCTCAGTGGTGAAATGAAAGC
GTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTTTT
CCAAATGTCCTCCAGCTGATTTGAAGGCCCCCCGGTACTGGGGACTCTTGGGTGCCATTT
CCCGGGAGTCCGCACACGCTGGACAGTGCCCGTGGACGCATATTTGGCTGCCTTCAACAC
CTCAGTCAGGCTTAATCAATTGCAAAGTCTCCTTTTGCCTGGGTCCTCCTGAAAATTTGT
GCTACATCCAGAGACCTCTATGCCTTGTTCTGAATACTGCATGATTCTCTCCTTCTGTCA
TGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCG
CGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTCCTGGGATCCCTGTC
TTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTCCCGCTTTCATG
GGGGTCAAGCCAACTGCCCGGGAAAGGGGAAGACGATGTGTGAACCCTCTCATCCACTGT
CCTTCCTGCGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTC
CTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTCGAAGAGAGATGATGA
CCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCCG
CCTTACCGATCTTCTTTAGAGCGGACCCCCATTTTGATTCCTTTCACCTGCACCAAGTAA
TCCAAAAGACCTGGGTGGCCGATTTTTGCCAAGCTGATTCCTTGGCTCTTTTCCTCTTTT
TGTGTCATTTAGAAAGACCTGCTTCCATGAAACTCACCGTGGCGAGGTCACAAGGTGAGG
GAATTACCGTGATTTTCCCTGGCCCCATCTGACACTTGGACAAGTGAGGATGCAGCCCAA
AAGGCAGTAGAGGTTGTTGACAAAGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGC
CTGGTTGACTAAGTGGCAGTGATGTGCGTGGATGGATACTCAGGAATCTGAGGATCCTGA
AAAATGTGCGCTTGAGTCGTCTCCGATAGCCGGGGTCCAAGTCCGATACATCCTAGGGAA
TTTTGAGAAATGCACAACGAGAAGAATGTATTTTCCCAAGATATTTATGGGAGGTGAATG
GCTCAGAGCTCTACGGGAGACTGGTCAACTTGCCATATTGAAAGCGTTTGTCAGTTTCAG
CTGGCTTCTTAGGATCTGCAGGGCACTTTTCCCAGGAATCTTGAAATTGGATGAGAGATT
CCGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATACCTGCGTA
GAAAATCTAAAGTCAGGGTCTATGCCACGTGTGAGGAGGACACGAGGGTCGTGAGCAGTT
TCAGGTTCATGCCACAGGAAGTCGTGTTTCCTTGGAGCTGTAGACAGTGAATGCAGGTGT
AAATGCTGCTTTGCACGAGTGCAAAGATCACTGTTCCTACACAGTTCATTGGAATCCCGT
AGAGTTTCCATAAGACTCCTGCTCTGTTTGTGCCAAGAGATCTTCTGATGGTTGATAAAC
AGGAGGAGATATGTTCCCTGTGTTACCGTTCTTTGGGAAAGAGGTGGCCGGGTCTGTGTC
TCTGCATGGCACAAGGGTGAAATCAAACTCCGGAAATTGGTAGGAGAAGTTTGGGGCAAA
TTCTTGGAGTAAGCACTTCTTTCTGAGTTGTCCCACCAGTCTCGTTTGAAGATCCCCAGT
TTGGGGAACCCTTGGGTGTAATTTCCTGAGAGTGCTCGTGCACGGGACAGTGCCTGTGGA
CACAGATTTGGCTTCCTTGTTACATGGGCCAGGGCTGATCAAAATGAAAAGCCTCTCCTT
GCCTGGGACCTCCTGAGTTTTTTTTACTACGGTCTGAGACCTCTATGCCATGTCCTGATC
TGGCACATGTCTGCCTTTCTGTCAAGGGTGAGCAGTCTCCCTAATGGGTTAGAAGTGCGT
GTCTTGATGTTGTCCATATTTTTGAGCACATGTGGGAAAAACCTTAGCTGTTAGACCATG
GATGTCTCTCGTCCGATGTCTGGCTTACTTCTTTGTCCTTCCTAAAAGGCTTGCAAGGTC
CAGGCCTGTTTTCCCGCTTTCATGAGGGTCAAGCTACTCCCCAGGAACCTGGAAGAGGAT
GTGCGAGCATTCTCATCCTGCATGATTCCGGGCTGGATGGAAGATGTCTGTGGTAAGGAA
CTTGAGGACTCAGGTGATTTTTCCTGGGGATTGATATGTCTCGGGTCAATGATGACACCT
CCACTTCTCTGGAAGAGAAATGATGACATTAAAATCACGCTCAATAGGATCACGCTGAGG
CCCAGAGGGAAACTGCTTTTCCCCAATCTTAATGATCTCCTTTAGAATGGAGCCCGTTTT
GATTCCTTTTACGTCCAGCACGTGATCGAAAACTCTTCACTGACCGATTTTTGTCAAGCT
GATTCCTTGGCTCCTTTCCTCTTTTTCTCTGACTTAGAAAGACCTACTTCCAAGAGATTC
ACCACAGGAAGAACACAAGGTGAGTGAATGATGGCAGTTTTACCTTGTCCCTGCTGATAC
TTGGACAAGTGAAAATGGAGCCCAAAAGGCAGTCGGGTTTTGTGGAGAAGCTGAGACGCG
TGCCCTGCTTTTAGCTTGACCTGACCGATTGAATAAGTGGCGGTGATATGCACGGGTGGA
TAGTTAGGAAGCACAGGAACCTGGAAGAATTTCCACTTGAGGAATTTTTGATCATCCGGT
GCCCAGCCTGGTATGTCTACGGAATTGAGAGACTGCACAGCGAGACAAATGTGCTTTTCT
CATATATTTTCCGCTTGGGAATGGCTAGGAGCTCTACTGGAGAAACCGGACATACTTGCC
ATAGTTGAAAGCCTGTGTCAGTTGCGACTGGACGATTAGGATCTGCCGGGTATCTTTCCC
ACAAATCCTGGCATTGGATGAACAATCGAGTAGTCTGATACCTCACTGTCGCTATCAAGA
AAAGGTAGCAGCACAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGTCCTTCCAG
CTGATTTGAAGATTCCCAGTTACTTGGGACTCTTGGGTGCCATTTCCCGGGAGTCCAATA
CGTTGGACAGTGCCCCTGGACGCATATTTTGCTGCCTTCAAGACACCAGTCAGGGTTAAT
TGATTGCAAAGGCTCCTTTTGCCTGTTTCCTCCTAAGAATTTGTACTACATCCAGGCACG
ATTCTCACCTTGTGTCAAGGGTCAACAGTCTCCCCAGTGGGCTGTAAATGAGTGTCTTGA
TTTTGTGCATATGTTTGCGAATATCTGGGAGAAAGCATAGCCATAGGGAAATGAGCTTCT
TTCCTGTGATCTTTGTCTTACTGATTTGCCCTTTTCCAAGGGATAGTGAGGTCGATGTCT
GTTGTCCTGCTTTCATGGGGGTCAAGCCAACTCCCCTGGAAACTGGAAGACGATGTGTGA
ATTCTCTCACCCAGTGTCATTCCTCAGTGGAAGAAAGACATTTGTGGTAAGCATCTTCAG
GTCTCAGGGGATTTTTCCTGGGGAGAGATATGGCTCGGGTCACTGATGACATAACCTGTC
TCGAAGAGAGATGATGACCTCAAAATCGTGCTCAGTGGGTTTATGCTGAGGCCCTGCGAG
ACACTCCTTTGCCCCGGCCTTATAGATCTTCTTTAGAGCAGACCCCCATTTTCATTCCTT
TCACCTACACCAAGTGATCCAAAACACCTGGGTGGCTGATTTTTGCCAGGCTGATTCCTT
GGCTCTTTTCCTCTTTTTGTGTCATTTAGAAAGACCTGCTTCCATGAAACTCACCGTGGC
GAGGTCACAAGGTGAGGGAATTACCGTGATTTTCCCTGGCCCCATCTGACACTTGGACAA
GTGAGGATGCAGCCCAAAAGGCAGTAGAGGTTGTTGACAAAGCTGAGGCATGTCCCCTGG
TGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCAGTGATGTGCGTGGATGGATACTCAG
GAATCTGAGGATCCTGAAAAATGTGCGCTTGAGTCGTCTCCGATAGCCGGGGTCCAAGTC
CGATACGTCCTAGGGAATTGGGAGAAATGCACAACGAGAAGAATGTATTTTCCCAAGATA
TTTATGGGAGGTGAATGGCTCAGAGCTCTACGGGAGACTGGTCAACTTGCCATATTGAAA
GCGTTTGTCAGTTTCAGCTGGCTTCTTAGGATCTGCAGGGCACTTTTCCCAGGAATCTTG
AAATTGGATGAGAGATTCCGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCT
GCACAGATACCTGCGTAGAAAATCTAAAGTCAGGTCTATGCCACGTGTGAGGAGGACACG
AGGGTCGTGAGCAGTTTCAGGTTCATGCCACAGGAAGTCGTGTTTCCTTGGAGCTGTAGA
CAGTGAATGCAGGTGTAAATGCTGCCTTGCACGAGTGCAAAGATCACTGTTCCTACACAG
TTCATTGGAATCCCGTAGAGTTTCCATAAGACTCCTGCTCTGTTTGTGCCAAGAGATCTT
CTGATGGTTGATAAACAGGAGGAGATATGTTCCCTGTGTTACCGTTCTTTGGGAAAGAGG
TGGCCGGGTCTGTGTCTCTGCATGGCACAAGGGTGAAATCAAACTCCGGAAATTGGTAGG
AGAAGTTTGGGGCAAATTCTTGGAGTAAGCACTCTTCTGAGTGTCCCACAGCTCGTTTGA
AGATCCCCAGTTTGGGGAACCCTTGGGTGTAATTTCCTGAGAGTGCTCGTGCACGGGACA
GTGCCTGTGGACACAGATTTGGCTTCCTTGTTACATGGGCCAGGGCTGATCAAAATGAAA
AGCCTCTCCTTGCCTGGGACCTCCTCAGTTTTTTTTACTACGGTCTGAGACCTCTATGTC
ATGTCCTGATCTGGCACATGTCTGCCTTTCTGTCAAGGGTGAGCAGTCTCCCTAATGGGT
TAGAAGTGCGTGTCTTGATGTTGTCCATATTTTTGAGTACATGTGGGAAAAACCTTAGCT
GTTAGACCATGGATGTCTCTCGTGCGATGTCTGGCTTACTTCTTTGTCCTTCCTAAAAGG
ATTGCAAGGTCCAGGCCTGTTTTCCCGCTTTCATGAGGGTCAAGCTACTCCCCAGGAACC
TGGAAGAGGATGTGCGAACATTCTCATCCTGCATGATTCCGGGCTGGATGGAAGATGTCT
GTGGTAAGGAACTTGAGGACTCAGGTGATTTTTCCTGGGGATTGATATGTCTCGGGTCAA
TGATGACACCTCCACTTCTCTGGAAGAGAAATGATGACATTAAAATCACGCTCAATAGGA
TCACGCTGAGGCCCAGAGGGAAACTGCTTTTCCCCAATCTTAATGATCTCCTTTAGAATG
GAGCCCGTTTTGATTCCTTTTACGTCCAGCACGTGATCGAAAACTCCTCACTGACCGATT
TTTGTCAAGCTGATTCCTTGGCTGCTTTCCTCTTTTTCTCTGACTTAGAAAGACCTACTT
CCAAGAGATTCACCACAGGAAGAACACAAGGTGAGTGAATGATGGCAGTTTTACCTTGTC
CCTGCTGATACTTGGACAAGTGAAAATGGAGCCCAAAAGGCAGTCGGGTTTTGTGGAGAA
GCTGAGACGCGTGCCCTGCTTTTAGCTTGACCTGACCGATTGAATAAGTGGCGGTGATAT
GCACGGGTGGATAGTTAGGAAGCACAGGAACCTGGAAGAATTTCCACTTGAGGAATTTTT
GATCATCCGGTGCCCAGCCTGGTATGTCTACGGAATTGAGAGAATGCACAGCGAGACAAA
TGTGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGAGATCTCAGTCTAGGAATCCTATGGGGCAGTTCTCCTCTGTATCCTTAAGCT
GCCGGGAAGTGATTATAGCTTATTTTTTCCCTTTGGAACTAATAATAAGTCAGGGGTCAT
ATGAATTTACAAAGGGAAAAAAAAGCTAGTTGGCATTTCTCCCCCCCGTCTCTATATAAA
AAAAAAATGTTTTCTTTTTTCCTTTCCCCGGTTTGCCTGTCTGCTCCTAAGAATTTGTAC
TACATCCAGGCACGAGTCTCAAATTGTGTCAAGGGTATAAAAAAAACCCCAGTGGGTTGT
AAATGGGTGTCTTGATTTTGTGCATATGTTTGCGACTATCTGGGAGAAAGCATAGCCATA
GGGAAGTGAGCTTCTCTCCTGTGATCTTTGTCTTACTGATTTGCCCTTTTCCAAGGGATA
GTGAGGTCGATGTCTGTTGTCCTGCTTTCATGGGGGTCAAGCCAACTCCTCCTGGAAACT
GGAAGACGATGTGTGAATTCTCTCACCCAGTGTCATTCCTCGGTGGAAGGAAGACATTTG
TGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGAGATATGGCTCGGGTCACT
GATGACATAACCTGTCTCGAAGAGAGATGATGACCTCAAAATCGTGCTCAGTGGGTTTAT
GCTGAGGCCCTGGGAGACACTCCTTTGCCCCGGCCTTATAGATCTTCTTTAGAGCAGACC
CCCATTTTCATTCCTTTCACCTGCACCAAGTGATCCAAAACACCTGGGTGGCTGATTTTT
GTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCATTTAGAAAGACCTGCTTCCA
TGAAACTCACCGTGGCGAGGTCACAAGGTGAGGGAATTACCGTGATTTTCCCTGGCCCCA
TCTGACACTTGGACAAGTGAGGATGCAGCCCAAAAGGCAGTAGAGGTTGTTGACAAAGCT
GAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCAGTGATGTGC
GTGGATGGATACTTAGGAATCTGAGGATCCTGAAAAATGTGCGCTTGAGTCGTCTCCGAT
AGCTGGGGTCCAAGTCCGATACGTCCTAGGGAATTTTGAGAAATGCACAACGAGAAGAAT
GTATTTTCCCAAGATATTTATGGGAGGTGAATGGCTCAGAGCTCTACGGGAGACTGGTCA
ACTTGCCATATTGAAAGCGTTTGTCAGTTTCAGCTGGCTTCTTAGGATCTGCAGGGCACT
TTTCCCAGGAATCTTGAAATTGGATGAGAGATTCCGTAGTCTGATAGCTGGCTCCAGCTT
TCAAGTGAAGGTAGCTGCACAGATACCTGCGTAGAAAATCTAAAGTCAGGGTCTATGCCA
CGTGTGAGGAGGACACGAGGGTCGTGAGCAGTTTCAGGTTCATGCCACAGGAAGTCGTGT
TTCCTTGGAGCTGTAGACAGTGAATGCAGGTGTAAATGCTGCCTTGCACGAGTGCAAAGA
TCACTCTTCCTACACAGTTCATTGGAATCCCGTAGAGTTTCCATAAGACTCCTGCTCTGT
TTGTGCCAAGAGATCTTCTGATGGTTGATAAACAGGAGGAGATATGTTCCCTGTGTTACC
GTTCTTTGGGAAAGAGGTGGCCGGGTCTGTGTCTCTGCATGGCACAAGGGTGAAATCAAA
CTCCGGAAATTGGTAGGAGAAGTTTGGGGCAAATTCTTGGAGTAAGCACTCTTCTGAGTG
TCCCACAGCTCGTTTGAAGATCCCCAGTTTGGGGAACCCTTGGGTGTAATTTCCTGAGAG
TGATCGTGCACGGGACAGTGCCTGTGGACACAGATTTGGCTTCCTTGTTACATGGGCCAG
GGCTGATCAAAACGAAAAGCTTCTCCTTCCCTGGGACCTCCTGAGTTTTTTTTACTACTG
TCTGAGGCCTCTATGCCATATCCTGATCTGGCACATGACTGCCTTTCTGTCAAGGTTGAG
CAGTCTCCCTAATGGGTTAGAAGTGCGTGTCTTGATGTTGTCCATATTTTTGAGCACATG
TGGGAAAAACCTTAGCTGTTAGACCATGGATGTCTCTCGTCTNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTGGTAAGGAACTTGAGGACTCATGTGACTTTTCATGA
GGATTGATAATGTCTCGGGTCAATGATGACACCTCCACTTCTCTGTAGAGAAATGATGAC
ATTAAAATCACGCTCAATAGGATCACGCTGAGTCCCAGAGGGAAACTGCTTTTCCCCAAT
CTTAATGATCTCCCTTAGAATGGAGCCCGTTTTGATTCCTTTTACGTCCAGCACGTGATC
GAAAACTCCTCACTGACCGATTTTTGTCAAGCTGATTCCTTGGCTGCTTTCCTCTTTTTC
TCTGACTTAGAAAGACCTACTTCCAAGAGATTCACCACAGGAAGAACACAAGGTGAGTGA
ATGATGGCAGTTTTACCTTGTCCCTGCTGATACTTGGACAAGTGAAAATGGAGCCCAAAA
GGCAGTCGGGTTTTGTGGAGAAGCTGAGACGCGTGCCCTGCTTTTAGCTTGACCTGACCG
ATTGAATAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTGGAAG
AATTTCCACTTGAGGAATTTTTGATCATCCGGTGCCCAGCCTGGTATGTCTACGGAATTG
AGAGAATGCACAGCGAGACAAATGTGCTTTTCTCATATATTTTCCACCTGGGAATGGCTA
GGAGCTCTACTGGAGAAACCGGACATACTTGCCATAGTTGAAAGCCTGTGTCAGTTGCGA
CTGGACGATTAGGATCTGCCGGGTATCTTTCCCACAAATCCTGGCATTGGATGAACAATC
GAGTAGTCTGATACCTCACTGTAGCTATCAAGAAAAGGTAGCAGCACAAATATCTGAGTC
AAAAAACTAAGGTCAGGTTCGATGGCATTTGGAAAACGCCATGCGCGCGTCATGACTAGT
TTCAGGTACGTGCCACAGGAAGTCACGATCGGCTAACACTCTAGTCAGGAAATGCAGGCA
TAACTGCTGCCTTCCACATGCGGAAAGATCATTTTCTTGACAGTTCTTTGGAATCTCATA
GAGATTCTGTAGAACTGCTTTTCTGTATGCCCCACAGGATCCTGTGGTGGTTGATATACA
GGAGGAGATGTTCTCCCTCTATAGGGATTATTCGGGCCTGAGGTAGATTGGATTGTGTCT
CTACATGGCTCAGTGGTGAAATCAAAGTGTTGAAGGACTGTGGAAATTTCTAGAAGTGTT
GGCACAATTCTTGGAAAGGAACTCATTTCCAAAGGTCCTTCCAGCTGATTTGAAGATCCC
CAGTTACTGGGGACTCTTGGGTGCCGTTTCCCGAGAGTCCAACACGTTGGACAGTGCCCC
TGGACGCATATTTGGCTGCTTTCAACACATCAGTCGGGGTTAATCAATTGCAAAGGCTCC
TTTTGCCTGCGTGCTCCTAAGAATTTGTACTACATCCAGGCACGAGTCTCACCTTGTGTC
AAGGGTCAGCAGTCTCCCCAGTGGGTTGTAAATGGGTGTCTTGATTTTGTGCATATGTTT
GCGACTATCTGGGAGAAAGCATAGCCATAGGGAAGTGAGCTTCTCTCCTGTGATCTTTGT
CTTACCGATTTGCCCTTTTCCAAGGGATAGTGAGGTCGATGTCTGTTGTCCTGCTTTCAT
GAGAGTCAAGCCAACTCCCCTGAAACTGGAAGACGATGTGTGAATTCTCTCACCCAGTGT
CATTCCTCGGTAGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGAGATTTTTC
CTGGGGAGAGATATGGCTCGGGTCAATGATGACATAACCTGTCTCGAAGAGAGATGATGA
CCTCAAAATCGTGCTCAGTGGGTTTATGCTGAGGCCCTGCGAGACACTCCTTTGCCCCGG
CCCTATAGGTCTTCTTTAGAGCAGACCCCCATTTTCATTCCTTTCACCTGCACCAAGTGA
TCCAAAACACCTGGGTGGCTGATTTTTGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTT
TGTGTCATTTAGAAAGACCTGCTTCCATGAAACTCACCGTGGCGAGGTCACAAGGTGAGG
GAATTACCGTGATTTTCCCTGGCCCCATCTGACACTTGGACAAGTGAGGATGCAGCCCAA
AAGGCAGTAGAGGTTGTTGACAAAGCTGAGGCATGTCTCCTGGTGTTTGCTTGACCTTGC
CTGGTTGACTAAGTGGCAGTGATGTGCGTGGATGGATACTCAGGAATCTGAGGATCCTGA
AAAATGTGCGCTTGAGTCGTCTCCGATAGCCGGGGTCCAAGTCCGATACATCCTAGGGAA
TTTTGAGAAATGCACAACGAGAAGAATGTATTTTCCCAAGATATTTATGGGAGGTGAATG
GCTCAGAGCTCTACGGGAGACTGGTCAACTTGCCATATTGAAAGCGTTTGTCAGTTTCAG
CTGGCTTCTTAGGATCTGCAGGGCACTTTTCCCAGGAATCTTGAAATTGGATGAGAGATT
CCGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTGAAGGTAGCTGCACAGATACCTGCGTA
GAAAATCTAAAGTCAGGGTCTATGCCACGTGTGAGGAGGACACGAGGGTCGTGAGCAGTT
TCAGATTCATGCCACAGGAAGTCGTGTTTCCTTGGAGCTGTAGACAGTGAATGCAGGTGT
AAATGCTGCCTTGCACGAGTGCAAAGATCACTGTTCCTACACAGTTCATTGGAATCCCGT
AGAGTTTCCATAAGACTCCTGCTCTGTTTGTGCCAAGAGATCTTCTGATGGTTGATAAAC
AGGAGGAGATATGTTCCCTGAGTTACCGTTCTTTGGGAAAGAGGTGGCCGGGTCTGTGTC
TCTGCATGGCACAAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved