Loxodonta_africana Locus Poly:35:SNORD99
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:35:SNORD99
Loxodonta_africana
Poly:35:SNORD99
GeneScaffold_7384
SNORA61, SNORD99
1001..1120, 2053..2132
2136
CTCGACCCTCCAGTTCCCTTTCCCATCGTATCTGAACACTGGCCTGGGTGGTCGTAAAA
GGAGGAAAAGTAACATTGAAACTGGCCTGAGTCGCATGTAGCACGTGGGCTAGTTTCAAA
CAAGATTCAGTTCACTGAATTTGTTTCCTTATCCCTTGGGATAATCATAGCTTAAAGGGA
TGAGTAAGTGAGTGACACTCTGAGCAGCTGGTGTAGCAGCGGCTGGACTATTAACTGTAT
TTGGGGGAGGGATCTAGTGTATAAGTTTTCTTGTTTCTTGATTAAAATTTTTTTTTTTTT
TTTTTTTAGATCTTCATTACTGGTAAAGTTGTGTCCATCTGTAATTAAAGATCTACAGAG
TTGGGTAAGTTGAACTTGTTATCACAACTTCCTTGGAGCTTTCAGGTAGTGCCTCCTCAT
GTGAACCCTGTCCTCAGGCAGTACAGCAGATGGAATGACAAGGCTACAAGTCTCCCTTTT
TCATAGATTACAGGTAGTCCCCAGTTTATGATGCCTTCTAGTTATGGTAAACTGCACTTA
AAACCCTTTTTTTGTACATTTTCCATTAGTGATATGTATTACATACAGTGTTGCAGTGTG
TAATTAATTTGCTGATATTATTCTCAGATGTTCAGTGTTAACATTTACCGTTCAAAACGG
GGACCTATAGCATACTATGGCAATAATAAGATAAAGCGTTTGACTTAAACATCAGAACTG
ACTTAGTTTGGAGTCACTGGAACAGAACTACATCTGACCTTATGTATTTGGTTAGCTACT
CACAGAGGCCAACTAACTATTTTCATTGTGGCTTAGTCTGTTGGATTTGCATGTCTTAAA
GCCACACAGCCTTAAGTCTACAGAGGGGAGAGCTCTGGACCTTGAGGAAAGAGGAGGGAT
GTGTGATTGCTGTGAATGTTTTATAGTCGCTCTGGCTCATGCTGGATTGTTTGGGGTGAC
TGCAAACCATGGCATTCTCCTCCCCACCCCTCCAAGGGTGGCAGGTGGATGGATAGAAAC
AAGTAGTTTCAGTTTAGCTGTTTTTTTTTTAAGGCCGACTGGTCCAGGATGAAACCTAAT
CTGAGTGGACATCTGTGGATGATAAATGCGGATATGGGACTGAGACCAGCTCTTAGAAAA
CTGCCCGAGTGAGCTTTAATCAGACCAGTACTAACACACTGGCTTACACTTCCTTTTCAG
GATTGAAGTGCTATGGGAAGAACAGACACCAAGTTTATATGGAAATAGCTCTGCAAGCAG
ACAGTCTTTTGGTTTTTATTTAGTGCTCTATCCTGGATACCTGGCAGAGGTGACAAATAA
AAAACTATGGAAATGTGTTAATCATCTTTCTTGGTTTCTCAAGTTGGGTTATTCCCAATC
TAAATATTCCATAGACCATAACTGAATAATCTCAATCCATGAAACAGACTGCCATCTCAG
ATGTGACAATTTGATCACCTCCAATAACTACATTTATACCAGAGTCTCCTTTCTTAATAC
TCAAGATTTTAAGGGTTTCATGATCTAGAGGAGCTCTTAGTGGCACGGTGATTAAGCAAT
TGGCTGCTAACGAAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTC
AGGATTACAGCCAAGAAAACCATATGGGGCATTTTACTCTCACAAAGGGCCACTATGAAT
CAACTCTACACTATCTAAGGTGGCCTAGATAGTTAATCGCCATATCTCACCATCAGTTGC
AGCACCTCCCCACTGCAATTTCTCTAGAGATCAGATGGAGATTTTTAGCCTAGACAGACC
ATTTAGGAGGTGTCCTGCATACTGGAGATAAAATTGGGGAGTGGTTTTTAGGAAATCACA
GAAGTGGGCTGTGATAAATGGACCTTAGTAATCTTCTCTGCATGTAAGATCTACAATTTA
ATGAAGGCCAAGCACTGTCACAGAGTGGGGTTAGGGATGAAGCACTTGGTTGGCCTCATG
CATGGTACTCTGAAAATCTAGTTCTTGGCTGAAATGTCTTGACAGCTCAGGATGACAATT
CGTTATTGGAACAAGTTTGCTGGAAATGAGTGGTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved