Loxodonta_africana Locus Poly:4:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:4:SNORD115
Loxodonta_africana
Poly:4:SNORD115
scaffold_9943
SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115, SNORD115
1001..1081, 2700..2777, 4523..4603, 6222..6299, 7922..8002, 9621..9698, 11316..11396, 13046..13123, 14743..14823
15468
GCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAA
CTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGG
AGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAG
CAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGA
ATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTT
GATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGA
CTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGG
GGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCA
GTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTG
GACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTC
TTGGCTGGGACTGCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATC
TGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGT
GTCTTGATTTCGTCCCTCTTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGA
ATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCG
AAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATG
TGCGAACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAAC
TTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGC
CCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCATTTG
GATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTCTGGTCATGCT
GATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTC
ACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACAC
TTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTG
TCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGA
TAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGT
TCCCAGTCGGGTATGCCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGG
ATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCT
GTGTCAGTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTAT
TGGATGAAGACTGGAGTAGCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCAC
CACTATCTGAGTCAAAAAGCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAG
CGTCATGACTAGTTTCAGGTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCA
GGCAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCT
TTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCATGTGCCCCACGGGATCCTCTGA
TGCTTGATATACGGGAGGAGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGA
TTCGATTGTGTCTCTCCATGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAAT
TTTAACAAGTGTTGGCAGAATTCTTGGAATGCTATTCTTTTCCAAATGTCCTCCAGCTGA
TTTGAAGATCCCCTGGTGCTGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACAT
TGGACAGTGCCCGTGGACGCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAA
TGGCAAAGGCTCCTTTTGCCTGGTTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCT
CTGCCTTCTTCTGAATATTGCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCA
GTGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGC
CTAGCCTTAGGGAAGTGAGTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTC
AAAGGGTTAGTGAGGTCGATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGGCAACTGCCC
GGGAAACTGGAAGATGATGTGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAA
GACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTG
GGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATTACCTAAAAATCATGCTCAGA
GAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAG
AGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGC
CGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTTGTGTCCTTTAGCAAAACC
TGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCC
TGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAAAGGCAGTAGGGTTTGCTG
ACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGG
TGATGTGCGTGGGTGGATACTTCGCAATCAGAGAATGCTGAAACATGTGCGCTGGAGTCG
TCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAATGGGAGAAACGGCCAACT
AGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGGCCCAGAGCTCTACAGGAG
ACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGGCTGGACTCGCAGGATTTG
CGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACTCAGTAGTCTGATAGCTGG
CTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATAGAAAATCTAAAGTCAGGG
TCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTTTCAGGTTGATGCCACAGG
AGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACAT
GTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGTAGAGGTTCCATAAGACTC
CTCCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCC
TGTGTTCCCATTCTTTGGGAATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGT
GAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGGATACATTCATTG
CCCAACGGTTATGCTTTCTCTGATGTTGCCTAAAAGAAGTTGGGGTTGATTCTTGGTGAA
AGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTTGGGAACCCTTGGA
TGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACACAGATTCGGCTTCC
TCGTAGACATTAGCCGGGGCTGATGAAATGAATAGCCTGTTCTTGGCTGGGACTTCCTGA
GTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCACGCGTCTGCCTTT
CTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTTGATTTCGTCCCTC
TTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGT
CTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTT
TCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATGTGCGAACCTTCTCATCCT
GCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATT
TCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAG
ATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAGGCCCACAGAGAAACTCCTTT
TCCCTAACGTTAATGATCTGCTTTAGAGGGGACCCCCGTTTGGATCCCTGTTTCCTCCAC
CAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTC
GTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAA
GGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGG
AGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTG
ACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGA
ACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCT
ACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGC
TCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCAGTTGCGACTGGA
CTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATGAAGACTGGAGTA
GCCTGACACCTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAA
GCTAATGCCAGGCTCAATACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAG
GTTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACT
GCTGCCTTCCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGAT
TCCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCCTCTGATGCTTGATATACGGGAGG
AGATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCA
TGGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAG
AATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTG
CTGGAGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGAC
GCATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTG
CCTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATAT
TGCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTG
TCTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGA
GTTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCG
ATGTCTCTTGTGCCGCTTTCATGGGGGTCAAGGCAACTGCCCGGGAAACTGGAAGATGAT
GTGTGAACTCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGATATTTGTGGTAAGCAT
CTTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAA
TCTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCC
TGTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGA
TTTCTTTCACCTGCACCAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGA
TTCCTTGGCTCTTTTGCCCTTTTTTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTTCACC
GTTGCGAGGACAAAAGGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTA
GGCAAGTGAGGATACACCTCAAAAGGCAGTAGGGTTTGCTGACAAAGCTGAGGCATGTCC
CCTGGTGTTTGCTTGACCTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATA
CTTAGGAATCAGAGAATCCTGAAACATGTGTGCTGGAGTCATCTGCGATAGCCTGCGTCC
AAGTCCGATACGGCCTACCGAAATGGGAGAAACGGCCAACTAGAAGAATGTATTTTCCGA
AGATATGTATGAAATGTGAATGGCTCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAT
TTGAACGCGTGTGTCAGTTGCGGTTGGACTCGCAGGATTTGCAGGGCGCATTTCCCATGA
ATCTTGAAACTGGATGAGCGACTCAGTAGTCCGATAGCTGGCTCCAGCTTTCAAGTGAAG
GTAGCTGCACAGATAAGTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGG
GCACACGAGGGTCAGGAGCACTTTCAGGTTCATGCCACAGGAAGTCATGTTTCCCTGGAG
CTCTGGACAGTGAAAGCAGGCGTAAGTGCTGCCTTGCACATGTGCAAAGATCACTGCTCC
TACAGAGTTGGTTGGAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAG
GAATCCTCTGATGGTTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGG
AATGAGGTGGCCTGGACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAAT
GCCTAGTTGAATTTGGGGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCT
CATTTGAAGATCCCCAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCA
CGGATCCGTGCCTGTGGACACAGATTCGGCTTCCTCGTAGACATTAGCCGGGGCCGATCA
AATGAATAGCCCGTTCTTGGCTGGGACTGCCTGAGTACTTTTCTTCCATTTCGGAGTCCT
CTATGTCTTGTCTTGATCTGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACT
AATGGGCGAGAAGTGTGTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGC
GTAGCTGTTAGGCAATGAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCT
CAAAGGATTGCAAGGTCGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCG
GGAAACCGGAAGAGGATGTGCGAACCTTTCTCCATCCTTGCGTGATTGCGGGCTGGATGG
ACGATATCGGTGGTGAGGAACTTGAAGACTCAGGTGATTTCTCCCGGGGATTGAGATGTC
TCGGGTCAACGAAGACACCTCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGC
TCAATAGGATCCCGCTGAGGCCCAGAGAGAAACTCCTTTTCCCTAACGTTAATGATCTGC
TTTAGAGGGGACCCCCGTTTGGATCCCTTTTTCCTCCACCAAGTGATCAAAAACTCCTCC
CTGACCGATTTTGGTCATGCTGATTCCTTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAA
AGACCTGCTTTCAGGAGATTCACCACCGAAAGAACTCAAGGTGAGTGAATGACGGCGGTT
TTCCCTTGTCTCTGGTGACACTTAGACAAGTGAAAATGGAGCCCAAGAGGCAGTCGGGTT
TTGTGGAAAAGCTGAGACGTGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTG
GCGGTGATATGCACGGGTGGATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTG
AGTAATTTTTGCTAGTCCGGTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTT
CAACTCTCAACTCTTTACGGGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAG
ACTTGCCAGAGTTGAAAGCCTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCAT
CTTTCCCAGACATCTCGGTATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCA
TTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGGCAGGTTCAATCCC
ATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGCCACAGGAGGTCAT
GATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTTCCACATGTGGAAA
GATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGAACTCCTTTTCCGT
GTGCCCCACGGGATCCTCTGATGCTTGATATCCAGGAGGAGATGTGATCCCTCTCTGGGG
ATTATTGGGGCCTGAGGTAGATTCGATTGCGTCTCTCCATGGCTCAGTGGTGAAATGAAA
GCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAATTCTTGGAAAGCTATTCTT
TTCCAAATGTCCTCCAGCTGATTTGAAGGTCCCCCGGTACTGGGGACTCTTGGGTGCCAT
TTCCCGGGAGTCCGCACACGCTGGACAGTGCCCGTGGACGCATATTTGGCTGCCTTCAAC
ACCTCAGTCAGGCTTAATCAATTGCAAAGTCTCCTTTTGCCTGGGTCCTCCTGAAAATTT
GTGCTGCATCCAGAGACCTCTATGCCTTGTTCTGAATATTGCGTGATTCTCTCCTTCTGT
CATGGGTCAGCAGACTCCCCAGCGGGTTGCAAATGGCTGTCTTGATTTTGTCCATGTGTT
CGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGGGATCTCTG
TCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTCCCGCTTTCA
TGGCGGTCAAACCAACTGCCCGGGAAACGGGAAGACGATGTGTGAACCCTCTCATCCACT
GTCCTTCCTGCGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGGATTTT
TCCTGGGGAGTGATATGGCTGGGGTCGATGATGACATAATCTGTCTGGAAGGGAGATGAT
GACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCC
AGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGT
AATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCCT
TTTGTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGA
GGGATTTCCCGTGATTTGCCCTGTCCCCATCTGACACTTAGGCAAGTGAGGATACACCGC
AAAAGGCAGTAGGTTTTGCTGGCAATGCTCAGGCATGCCCCCTGGTGTGTGCTTGACCTT
GCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGAATCCT
GAAAAATGTGCGCTGGGGTCATCTTCGATAGCCTGGGTCCGAGTCCGATACGGCCTACTG
AATGGGAGAAACTTCCAACTAGAAAAATGGGTTTTCCTGAGATATTTATGAGATGTGAAT
GGCTCAGAGCTCTCCAGGAGACCGGTCAACTTGCTGTAATGGAAAGCGTGTGTCAGTTGC
GGCTGGAGTCGCAGGATTTGCAGGGCGCTTTTCCCGTGAATCTTGAAATTGGATGAGGGA
CTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCG
TAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACATGAGGGTCAGCAGCAC
TTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGC
ATAAGTGCTGCCTTGCACATGTGCAAAGATCACTGTTCCTACAGAGTTGGTTGGAATCCT
GTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTTGATTA
ACAGGAGGAGATGTGTTCCCTGTGTTGCCATTCTCTGGGAATGAGGTGGCCTGGACTGTG
TCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGCAATGCCTAGTTGAATTTGGGGCCA
AATTCTTGGTGAAAGCACTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCAGTTTT
GGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTGTGGACAC
AGATTCGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTCTTGGC
TGGGACTGCCTGAGTACTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATCTGGCA
CGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGTGTCTT
GATTTCGTCCCTCCTTTGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAATGAATGTC
TCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCCTCAAAGGATTGCAAGGTCGAAGCC
TGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATATGCGA
ACCTTCTCATCCTGCGTGATTGCGGGCTGGATGGACGATATCGGTGGTGAGGAACTTGAA
GACTCAGGTGATTTCTCCCGGGGATTGAGATGTCTCGGGTCAACGAAGACACCTCAACTT
GTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGTATCCCGCTGAGGCCCAGA
GAGAAACTCCTTTTCCCTAACGTTAATGATCTGCTTTAGAGGAACCCCCGTTTGGATCCC
TTTTTCCTCCACCAAGTGATCAAAAACTCCTCCCTGACCGATTTTGGTCATGCTGATTCC
TTGGCTCTTTTCGTCTTTTTCTGTCATTTCGAAAGACCTGCTTTCAGGAGATTCACCACC
GAAAGAACTCAAGGTGAGTGAATGACGGCGGTTTTCCCTTGTCTCTGGTGATACTTAGAC
AAGTGAAAATGGAACCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACGTGTCCCCT
GCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACGGGTGGATAGTTA
GGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCGGTTCCCAG
TCGGGTATGTCTACGGAAGTTTGAGAAGATTTTCAACTCTCAACTCTTTACGGGATGGGA
GTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGCCTGTGTCA
GTTGCGACTGGACTCTTAGGATCTCCAGGGCCTCTTTCCCAGACATCTTGGTATTGGATG
AAAAAGGGAGTAGCCTGACACCTCGCTGTAGCATCAAGAAAAGGCAGCAGCNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGAAATTGTGCTACATCAGAGACTCTATGCTGTTCTGAATACTGCATGATTCTCTCA
TCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGTCTTGATTTTGTCCAT
GTGTTCGCGAATGTCTGGCTGAAAGCATAGCCTTAGGGAAATGAGTTTCTCTTCTGGGAT
CTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGATGTCTCTTGTCCCGC
TTTCATGGGGGTCAAGCCAACTGCCCGGGAAACGGGAAGACGATGTGTGAACCCTCTCAT
CCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATCTTCAGGTCTCAGGGG
ATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAG
ATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTT
GGCCCCGCCTTACCGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCAC
CAAGTAATCCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTC
CTCTTTTTGTGTCCTTTAGCAAAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAGA
GGTGAGGGATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATAC
ACCGCAAAAGGCAGTAGGGTTTGCTGGCAAAGCTGAGGCATGTCCCCTGGTGTGTGCTTG
ACTTTGCCTGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTAGGAATCAGAGA
ATCCTGAAAAATGTGCGCTGGGGTCATCTTCGATAGCACTGGGTCCAAGTCCGATACGGC
CTACCGAAATGGGAGAAACGGCCAACTAGAACAATGTATTTTCCCAAGATATTTAGGAGA
TGTGAATGGCCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGT
CAGTTGCGGCTGGACTCGCAGGATTTGCGGGGCGCTTTTCCCATGAATCTTGAAATTGGA
TGAGCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGAT
AACTGCATAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCA
GGAGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAA
AGCAGGCGTAAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTAGAGAGTTCGTTG
GAATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGG
TTGATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTTGGGAATGAGGTGGCCTG
GACTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCGGGAAATGCCTAGTTGAATTT
GGGGCCAAATTCTTGGTGAAAGCACTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCC
CAGTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGATCCGTGCCTG
TGGATACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGT
TCTTGGCTGGGACTGCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGA
TCTGGCACGTGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGT
GTGTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCATAGCTGTTAGGCAAT
GAATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGT
CGAAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGA
TGTGGGAACCTTCTCATCCTGAGTGATTGCGAGCTGGATGGACGATATCGGTGGTGAGGA
ACTTGAAGACTCAGGTGAATTTTCCCGGGGATTGAGATGTCTCGGGTCAATAAAGACACC
TCAACTTGTCTCGAAGAGAGATGATGACATAAAAATCATGCTCAATAGGATCCCGCTGAG
GCCCAGAGAGAAACTCCTTTTCACTAACATGAATGATCTGCTTTAGAGTGGACCCCCATT
GTGATCCCTTTTTCCTCCACCAAGTAATCAAAAACTCCTCCCTGACCGATTTTGGCCATG
ATGATTCCTTGGCTCTTTTCCTCTTTTTCTGTCATTTAGAGAGACCTGCTTTCAAGAGAT
TCACCACCGAAAGAACTCAAGGTGAGTGAATGACGACGGTTTTCCCTTGTCTCTGGTGAA
ACTTAGACAAGTGAAAAGGGAGCCCAAGAGGCAGTCGGGTTTTGTGGAAAAGCTGAGACG
TGTCCCCTGCTTTGAGCTTGACCTGACCGATTGACCAAGTGGCGGTGATATGCACAGGTG
GATAGTTAGGAAGCACAGGAACCTAGAAGAATTTCCACTTGAGTAATTTTTGCTAGTCCG
GTTCCCAGTCGGGTATGTCTACGGAAGTTTGAGAATATTTTCAACTCTCAACTCTTTACG
GGATGGGAGTGTGTAGCAGCTCTACTGGAGAAACCAGAGAGACTTGCCCTAGTTGAAAGC
CTGTGTCAGTTGCGACTGGACTCTTAGGATCTCTAGGGCATCCTTCCCAGACATCTCGGT
ATTGGATGAAGAATTGAGTAGCCTGATACCTCGCTGTAGCATCAAGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved