Loxodonta_africana Locus Mono:64:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:64:SNORD115
Loxodonta_africana
Mono:64:SNORD115
scaffold_192768
SNORD115
1001..1078
1200
TGACACCTCGCTGTAGCATTCAAAGAAAAGGCAGCAGCACCACTATCTGAGTCAAAAAG
CTAATGCCAGGCTCAGTACCATTCGGTACGTGGGTCGCGAGCGTCATGACTAGTTTCAGG
TTCATACCACAGGAGGTCAGGATCTGCTGACAGTCTAATCAGGCAATGCAGGCATAACTG
CTGCCTTCCACATGTGGAAAGATCATTTTCATAACAGATCTTTGGAATCTTGTAGAAATT
CCATAGAACTCCTTTTCCGTGTGCCCCACGGGATCATCTGATGCTTGATATACGGGAGGA
GATGTGTTCCCTCTCTGGGGATTATTGGGGCCTGAGGTAGATTCGATTGTGTCTCTCCAT
GGCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGA
ATTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCGGTGC
TGGGGACTCTTGGGTGCCATTTCCCGGGAGTCCGCACACATTGGACAGTGCCCGTGGACG
CATAGTTGGCTGCCTTCAACACATCAGTCAGGCTTAAGCAATGGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGTAAATTTCTGCTACATCCAGAGACCTCTCTGCCTTCTTCTGAATATT
GCATGATTCTCTCCTGCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTCGTGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAG
TTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCATAGGGAGTGATATGGCTGGGGTCAATGATGACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGTCCTTTGGCCCAGCCTTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGAT
TTCTCTCCCCTGCAGCAAGCAATCGCAAACGTGCTCAGTGTCCGAGTTATTCAACAGATT
C
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved