Loxodonta_africana Locus Mono:72:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:72:SNORD115
Loxodonta_africana
Mono:72:SNORD115
scaffold_221682
SNORD115
1001..1078
1089
CTCGCTGTAGCATTCAAGAAAAGGCAGCAGCACCAATATCTGAGTCAAAAAGCTAATGG
CAGGTTCAATCCCATTCGGTAAGTGGGTCGCGAGCGTCATGACTCATTTCAGGTTCATGC
CACAGGAGGTCATGATCCGCTGAGAGTCTAATCAGGAAATGCAGGCATAACTGCTGCCTT
CCACATGTGGAAAGATCATTTTCTTGACAGATCTTTGGAATCTTGTAGAGATTCCATAGA
ACTCCTTTTCCGGTGTGCCCCACGGGATCCTTCTGATGCTCTGATATCCAGGAGGGAGAT
GTGATCCCTCTCATGGGGATTATTGGGGCCTGAGGTAGATTTCGATTGTGTCTCTCCATG
GCTCAGTGGTGAAATGAAAGCGTTGAAGGACTGTGGCAATTTTAACAAGTGTTGGCAGAA
TTCTTGGAAAGCTATTCTTTTCCAAATGTCCTCCAGCTGATTTGAAGATCCCCCCGGTGC
TGGGGACTCTTGGGTGCCATTTCCCGGGAGTCTGCACACATTGGACAGTGCCCGTGGACA
CATATTTGGCAGCCTTCAACACATCAGTCAGGCTTAATCAATGGCAAAGGCTCCTTTTGC
CTGGGTCCTCCTGAAAATTTGTGCTACATCCAGAGACCTCTATGCCTTCTTCTGAATATT
GCATGATTCTCTCCTTCTGTCATGGGTCAGCAGACTCCCCAGTGGGTTGCAAATGGCTGT
CTTGATTTTGTCCATGTGTTCGCGAATGTCTGGCTGAAAGCCTAGCCTTAGGGAAGTGAG
TTTCTCTTCTGGGATCTCTGTCTTACTGATTTCCCCTTTTCAAAGGGTTAGTGAGGTCGA
TGTCTCTTGTGCCGCTTTCATGGGGGTCAAGCCAACTGCCCGGGAAACTGGAAGATGATG
TGTGAACGCTCTCATCCACTGTCCTTCCTGGGTGGAAGGAAGACATTTGTGGTAAGCATC
TTCAGGTCTCAGGGGATTTTTCCTGGGGAGTGATATGGCTGGGGTCAATAATAACATAAT
CTGTCTGGAAGAGAGATGATGACCTAAAAATAATGGTCAGAGAGGTTATGCTGAGGCCCT
GTGGGAAAGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved