Loxodonta_africana Locus Mono:79:SNORD60
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:79:SNORD60
Loxodonta_africana
Mono:79:SNORD60
GeneScaffold_475
SNORD60
1001..1083
2083
CTAGTGGGTGGAGACCAGGGACGCTGCTCAACATTTTACAATGCGCAGGACAGTACCTA
ACACAAAGAACGATCCAGCCCGAGCTGTCAACAGCTCCGAGGGAGAGAAACCCTGCACTC
TAAAACGAGCAGATGAAAATTCGGGTCCTGTTCCTCCGCAGTCTCCCAGGCGCCTAGAAC
AGTGCCTGGCACCTAGGCGGCAATTAATAAATGTAGAAGGAATGAGTAAAAAACAAGAGA
TTGAAGGGATGGAGTCAGTGAAGAACAAGCTGACAGGCAAATGGACTGACACAGAGACCC
CGGCCCGGCTCAGCCCCGCCCCCCCCCCGGGGAGACCCCCCTCGCCCGTACCCCTACGCA
TCCGCTCCCCACCCCCAGCGCGCGCCCCCCAGGCGCGATCCCCGGGTCCTGAACGCCGCG
CGGACACTCACCCGCCCCCTGCCACCGGGGAGCACTAGCACGGCCCGCCGGCTCCATCGT
GCCCCTTCGGCCGCGGGCCGGGAAACCGACCGGACGCGCGAGCCGGAAGTACCCACGCGC
CGCGCCCGCCGGGACTTGTAGTTCCCGGGCTCTGGGGGCCCGGGCAGCGGCCTGACTCTC
GTCGCTTCAGAAACTACGACTTCCGGCGGCCCAGACTCCGCGGGGCGGGATTGGCAGCTT
CAGAATCGGGTAGAGAGCATAGCCTATCAGGTACGAGTAGGGCAGATACTTCCGTTAGGA
TTGTTCAATCACAGAAGTGGGACAGTTTCTATAAAGGCTTGAGCCTCGTGCATCCGCGTT
CTTTCCGGTTGCGTGTGAGCACGATACTTACGCGTAGCTGTCGGGGCTGAGGGAGTTTCT
CGAACCCTGCAAGCTGGCTTAGCTCTGGATTAAGCCTCCACCTGAGCTGCACATGGGTCC
TAGCGGATCCCAAGGTTTTCCTTCGCGGGAGTCCGAATTTCCAGACCCACATCTCCGTCC
GGGTAAGCCCGGGCCGGGCCTTTTCCCCAGACGCAGCTCCGAGCCTGTGATGAATTGCTT
TAATTTCTGACACCTCGTATGAACACTGTACGTGCAGTCTGATTATTTTGCAAGACTGAG
GCTTCAGGGTGCGTGACCTTGATGGGGAGGAGGATTGGGAGTGAAACCACTTGCCCCAAA
CGGTGGAGGGGGCTACTGTTTATATCTCGGCGCTATCTGGTTTTCAGGGCCATCGTGGAA
CCGGCTGCAGACCCTGAGCCAAAGTCAACTTCTTGAGCCCAGCGGGCAGCAGGGCCTGGT
GGTAAGGTGGCCGTCTGTGTGTCCGAGATACTTAGTAATAAAGTAGAGGTGGTTAACTGA
TGCTGTGTTAGCTCTTCTTATTCGCCTGCCACGTGCCGCCCTGAGGACTGCTCATCTTGG
ATGGAAGTTGGGAAGGGTTGGGGCAGAGACATCAAGGTGGTATTTCTTGGCGTCTCTTGC
TGCTGCCTTCTCCGTTTTTTGGCTACAATGCTAAGAAAGATTGGGCTTTGTGCTGTTGCA
TGGAGTGGGTCTTGAGCTCTCACTAGCAGACCACGGAGTGCCCTTTGAAGCCTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved