Loxodonta_africana Locus Mono:63:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:63:SNORD115
Loxodonta_africana
Mono:63:SNORD115
scaffold_189452
SNORD115
1001..1079
1133
GCGACTCAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAA
CTGCGTAGAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGG
AGCACTTTCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAG
CAGGCGTAGGTGCTGCCTTGCACATGTGCAAAGATCACTGTTCCTACAGAGTTCGTTGGA
ATCCTGTAGAGGTTCCATAAGACTCCTGCTCTCTTTGTGCCAAGGAATCCTCTGATGGTT
GATAAACAGGAGGAGATGTGTTCCCTGTGTTCCCATTCTTGGGGAATGAGGTGGCCTGGA
GTGTGTCTCTCCATGGCACAAGGGTGAAATCAAACTCTGGAAATGCCTAGTTGAATTTGG
GGCCAAATTCTTGGTGAAAGCCCTCTTCCGAGTGTCCCACAGCTCATTTGAAGATCCCCA
GTTTTGGGAACCCTTGGATGTCATTTCCTGGAAGTGCTCGTGCACGGAACAGTGCCTGTG
GACACAGATTTGGCTTCCTCGTAGACATTAGCCGGGGCTGATCAAATGAATAGCCTGTTC
TTGGCTGGGACTTCCTGAGTATTTTTCTCCATTCGGAGTCCTCTATGCCTTGTCTTGATC
TGGCACGCGTCTGCCTTTCTGTCAAGGGTCAGCAGTCTCACTAATGGGCGAGAAGTGTGT
GTCTCGATTTTGTCCATACTTGGGGCTATATGTGGAAAAAGCGTAGCTGTTAGGCAATGA
ATGTCTCTCGTCTGATGTCTGACTTACTTCTTTGCCCTTCTTAAAAGGATTGCAAGGTCG
AAGCCTGTTTTCCTGCTTTCATGAGGGTCAAGCTACTCCCCGGGAAACCGGAAGAGGATG
TGGGAACCTTCTCATCCTGCGAGATTGCGGGCAGGATGGACGATATCGGTGGTGAGGAAC
TTGAAGACTCAGGTGATTTTTCCCGGGGATTGAGATGTCTCGGGTCAATGAAGACACCTC
AACTTGTCTCGAAGAGAGATGATGACATAAAAATCGGCTCAATAGGAACCGCTGAGGCCC
AGAGAGAAACTCCTTTTCCCTAACCCCCATGGTCTGCTTTAGAGTGGACCCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved