Loxodonta_africana Locus Mono:75:SNORD16
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:75:SNORD16
Loxodonta_africana
Mono:75:SNORD16
GeneScaffold_5660
SNORD16
1001..1099
1810
CGGAAGGAGGCAGTGGTTCGGTTGTAAACAGTAGTTAGGGAGCTTCGAGAAGGTGGCCT
GAAGGAGGTGAAAAATGCCAAGGGGATCCGTAGGGTGAAGGCTTGCTACCTCTGAAGCTG
GAGGGTAATGGGCCTGATGGTACAGACAAAAGTATCTGGAAGACTGTAAGAGATGGTATC
AGGTCTGTAGGCCAGCCTAAGGACCCTTCCAATCCGAGGGTGGGAATCCTTTAGAGGGTG
TTGAGCACAGTTAACATGACTGGTGTTTTTATTAGTAAGCTGTAGAAGATGTGTTTAGAA
GGGAAGTGTGGAAGCAGAGATGGAAGTTTGGATGAGTAAAGCCCTGGTAGACAAGATTTG
CTGACACATTTGTAGGGGGGAGAGATTAGGTGGCAGTATTAAATAGCATTTTCAAATTTT
ACAGTGTGGCTTAGATTCAGCATTGTTCTTTATAAGGCCTGCTTTGGAAACTTGATGATA
AACCATTCTCTGAAAATTTTGTGGCAAGACATCAAATTAAGCTGTCATGTGGAATGTAGC
AGATTGTACGTCATTTACTCATATTAATAGAGTTTGGAAACAGACATGTCCAAAATATAA
ATGTATCCCTGTTAAATACTGCTCTAGACAGATTTGTAACTTGGAAGATGTTTATGTCGT
GAGTTTATTCTTAAAGGGCACAGGGCAGTTCTTAACATTAGAAAGTTTTGCTTGCAATGA
TGTCGTAATTTGCGTCTTACGCTGTTCTCAGTGACAGATGCCTGCTGTCATTAAGCTGGT
ACAGAAGGTTGACGAAAATTTCTACTGAGCAAGACATTACCTTTTTTTAATTCCTAGAAC
ATGAGAAATGGTGTTCTTAACTAGTAGAAGTGCCCCTGAAGTATGGGCGAATTTTTTGAA
GTTAAACCTGTTCTGGGTGTGTTGGTAGCTTAGCCTTGCTTGTCATGGTGTTTGTTGCCT
GTTTTAGCTCAGCTCTATAGCTGAGATGAGTATGCCTCCAGCGATGATGCTCACCAGCAT
AGGTTAACCTTTTCCTTTTTCCCCAAGGCGTGTGCTCGTCCACTGATATCGGTGTACTCC
GAAAAGGGAGAATCATCTGGCAAAAATGTTACTTTGCCTGCTGTGTTCACAGCTCCCATT
CGACCAGATATCGTGAACTTTGTCCACACCAACTTACGCAAAAACAACAGGCAGCCCTAT
GCTGTCAGTGAATTGGCAGGTATGGATTTAGACCTCACACAGGTTGGTATCTTAGGGTTG
CTTTACAGTAGTGATGAGATTACACTTAATTGGTCCGTGTTTCTGAACCACATGATTTTC
TTGGGTGTTCTGATGCTGTTTGCTACCATGTGTAATGGCCACACATGGGTGTGATTGAGT
AGCTAAAGCGTGCATTTCTTTCCAATTTTAGGTCATCAGACCAGTGCTGAGTCCTGGGGT
ACTGGCAGAGCTGTGGCTCGAATTCCCAGAGTTAGAGGTGGTGGGACACACCGCTCCGGC
CAAGGTGCTTTTGGAAATGTATCCTTTTTGGTTTTACTGCCTGGACATAGTCACCTGTCA
TGCAGGATTTAGCAAACTGAACCTGATGTGTTCATATTAATAATTCAGTTTGGACATAGG
CATGTCCAAAATACTCGCTGTATCCCTGTTAAATACTGCTCTAGACAGATTGGGAATCTG
GAAGGTACTTATTTCTGTGGCAGTTCTGAAGTTAGAAAGTTTTGCTTGCAATGATGTCGT
AATTTGCGTCTTACTCTGTTCTAAGCGACAGTTGCCTGCTGTCATTAAGCTGGTACAGAA
TGTTGACGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved