Loxodonta_africana Locus Mono:68:SNORD83
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:68:SNORD83
Loxodonta_africana
Mono:68:SNORD83
scaffold_210666
SNORD83
1001..1077
1201
CCAGCCCCGATCAGGCCGTTTTCTTATACCCTTTCCCACCCATAATTACAGAGAGATTT
CCCTAAGCAGCGGAAGGGGGCGGTCTGAGGAGTTTGGCTGGAAAGCTGTGGAAGGAGGAA
TGGCAGCCACATGATGTTTCATATTGAGAAATGAGCGCTTTACGCTATGATGACCTTAAT
CTATCACCCTTGACTGATGGCTGCTGGGTAGGGGGTCAACACCTTGAGACTGTAGTTAGG
GACAGCACAAGGTTTTCCTTTGAGAATTTTTCGAGACTTCATCTTATTTGCATTTCTCAC
CTCCCTAGTCTAGCTGTTAAGGTATTCTGTTTTTCATTGCTTATTCTTTTTTTTACTGCT
ACTTATAGGCCACTGGGTTGTGCAAAGTGTTCAGCGCTTGATTACTAACCAAAATGTTGG
CTGTTCGAACCCGCCCAGAAGCGCCTTGGCAGACAGGCCTGGCAGTGTGCTTTGGAAAGG
TTACAGCCTTGAAAACGCAACGGAGTAGTTGTATACTGCATACGTGGGTCACCATGGTAG
GACTCCACACAACTGACAGTGTTGCTAATTAAAAAAACCTGTTGCTGTGGGGGCTTCTGA
TTTATAGCAACCCTATGGGACAGAGTAGAACTGCCCCATAGGGTTTCCAAGGCTGTAATC
TTTTGGGCGTAGTGGTTAAGTGCTACGGCTGCTAACCAGAAGGTCAGCAGTTTGAATCCA
CCAAGTGCTCCTTGGAAACTATGGGGCAGTTCTAGTCTGTCCTGTAGGGTCACTCTGAGT
CAGAACCGATTCCAGGACAATAGTTTGGTTTAATCTTTGGGGAAGCAGATTGCCACATCT
TTCTTCTGCAGAGTGGCTGATGGGTTTGAATCACTGACTTTTCTGTTAGCAGCCTAGTGC
TTAATGACTGCGGGCCACCAGGGCCTCTCATTGCTAATTACAAGTCAGGAGTTTATAAGC
TGGTTTTCATTATCTTAATTTCCTGGTTTCTGCTACTCTGATACTAGTCTTGTTGGGACC
CTGTGTCCTGACTACCTGCTCGTGGGAATACTTTTTCCCATTTAAATAGAATTAACCTTG
CGTGTTTTGTATTTTGTTACCGTTTCTCTCTCAGGAAGAAGGTTTTCATATTTTAGGGAA
AGAAGAATAAGTGGTGCCTGATGAAAGACTTAGAGATCCTGGAAGGGCTTTTGCTCCGGG
GA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved