Loxodonta_africana Locus Poly:29:SNORA1
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:29:SNORA1
Loxodonta_africana
Poly:29:SNORA1
GeneScaffold_6514
SNORA8
1001..1139
2502
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGTACAACATGC
CATTACCGTTGTAACTAGGAATTATTATTATAGGGATAAAATACAGAATCAAAACCTTGG
CAAAAATATTGGCTACAATATTTGTATATGTAGAATGAAATAAACAAGAGGTTGCATGTT
GAGGCTATCAAATGCTGAAGCCTGAGTCAATATTGAGTTAGCAGATGAAATTCTTTTTTG
TGCCTTTTTCAGGTTGCAGCTTCATATCGTTTCTCCTAATACCATGCATACTTGGATATG
TTTGATTCAGTTAGGGATGATGAATTGCTTTAAAGCAGTTCTGATTAATAGCACAATTGA
GCAACAGTGAATTGACACCGCCAGTGTATTGTTTCTTTTAGTGATCTGACTTAATTGCTA
TGTAAGTTAAATATAGGAGACAAGATTAAGATTACTAGTGACAAGGTCGATAGTTTAAAA
TGCAGCAATATTTCCTTTTGGAATAATAATTGGGAATAAAGGTTAAATTGTGTACCTGTT
AGAGGAACTTTGGGTTTTTAAGAGATGTGTGAAAGTAAGCTTATTTCTGAAAGGAGTAGC
ACTGGAGACTTCGGGAAGTGAGTGGGTTGTAGTTGAATCGCTGCACTGCATGGTATCTGC
ATTCAGCAGTTCACTCCTGCTGGGATGTTCCAAGGACAGTGCGACAGAAATTCAGTAGCT
GGCATCGTTGGTTTTCTTGGCTTTGTGCATGTTAAACCTGGTATTTCTATTGGTACAGTT
TATATAGTTAAATACTGCCAAGTTGGTTATAATCTTCATTAGGAACTAATTATTTTCTTT
TTCTAGGATGTCTGAAATTAAGAGTAAGGCAGAATCTATGTACACGGATCCTAAAATGTA
AGGCTTTATATTTCTGTTGCTTTTAGCAGTTATCCCTATTGGTAGCAACATCCATTGTAT
TTAAAAGTGTACTGTAATGTGCTGCGTTTGAGGAACAACTTTTATTCTGTAGCCTCATTT
TTTGTGAAAATGGGCACAGTTGATCATGGTGTCCAGAAATTGTCAATGTGGCTAAATTAA
GACAGGTTTTGCTTCCATCACAGTGAACTAATTGCAGTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved