Loxodonta_africana Locus Mono:67:SNORD115
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:67:SNORD115
Loxodonta_africana
Mono:67:SNORD115
scaffold_203969
SNORD115
1001..1078
1095
GGGGAGTGATATGGCTGGGGTCAATGATGACATAATCTGTCTGGAAGAGAGATGATGAC
CTAAAAATCATGCTCAGAGAGGTTATGCTGAGGCCCTGTGGGAAAGTCCTTTGGCCCAGC
ATTCCAGATCTTCTTTAGAGCGGACTCCCATTTTGATTTCTTTCACCTGCACCAAGTAAT
CCAAAAGACCTGGGTGGCCGATTTTGGTCAGGCTGATTCCTTGGCTCTTTTCCTCTTTTT
GTGTCCTTTAGCACAACCTGCCTCCGAGGAGTTCACCGTTGCGAGGACAAAAGGTGAGGG
ATTTCCCGTGATTTGCCCTGGCCCCATCTGACACTTAGGCAAGTGAGGATACACCGCAAA
AGGCAGTAGGGTTTGCTGACAAGGCTGAGGCATGTCCCCTGGTGTTTGCTTGACCTTGCC
TGGTTGACTAAGTGGCGGTGATGTGCGTGGGTGGATACTTCGGAATCAGAGAATGCTGAA
ACATGTGCGCTGGAGTCGTCTGCGATAGCCTGGGTCCAAGTCCGATAGGGCCTACCGAAA
TGGGAGAAACGGCCAATTAGAACAATGTATTTTCCCAAGATATTTATGAGATGTGAATGG
CCCAGAGCTCTACAGGAGACTGGTCAACTTGCTGTAATTGAAAGCGTGTGTCAGTTGCGG
CTGGACTCGCAGGATTTGCGGGACGCTTTTCCCGTGAATCTTGAAATTGGATGAGCGACT
CAGTAGTCTGATAGCTGGCTCCAGCTTTCAAGTAAAGGTAGCTGCACAGATAACTGCATA
GAAAATCTAAAGTCAGGGTCGATGCCAGGTGTGAAGGGGACACGAGGGTCAGGAGCACTT
TCAGGTTGATGCCACAGGAGGTCATGTTTCCCTGGAGCTCTAGACAGTGAAAGCAGGCGT
AAGTGCTGCCTTGCACATGTGCAGAGATCAGTGTTCCTACAGAGTTCGTTGGAATCCTGT
AGAGGTTCCATAAAGACTCCTGCTCTCTTTGTGCCAAGGAAATCCTCTGATGGTTGATAA
ACAGGAGGAGATGTGTTCTCTGTGTTCCCATTCTTTGGGAATGAGAGTGGCCTGGGACTG
TGTCTCTCCATGGCAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved