Loxodonta_africana Locus Mono:92:SNORD15
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:92:SNORD15
Loxodonta_africana
Mono:92:SNORD15
GeneScaffold_4797
SNORD15
1001..1148
2148
GTCGCGCAGAATATTTGTCGTCCTTCCGCCGCCCCTTTATACCCACTTCCGCGCGCGAC
CCACTTCCTTTTCTTTCGGGCTGCGCGCGGCGGCAAGATGGCGGTGCAGATTTCCAAGAA
GCGGAAAGGTGAGATGCTGAGGCCTGAGCTCAGGGAGCTGCGGCGCTGCGCGCGCCAGAG
GGTTCTCAAGGTGCCAGCGCGAGGCTTGCAGCTGTGTGCTTTGCCCCAAGAAGCGGCTCG
AACGCATGGCGTTCCCGGGGGCCGCGGATGGCTTTGGATTGAGTGCGGGACTCGACCTGG
GCTAGCACAGTGTGGCGCCGGGGAGGGGAGAGACGGACGAATTTCTGTCGGTTCCGGGCA
GGGTACAGAGATGAGCCCGGGGCGACCCACCTGCCCTAGAGAAAGCGCTGATGCATATTT
TTTCGTAAAAAAAAAATATATATAAGTATTAGTAAACGTGGCGTTTCGAGGGCGTGAGCA
ATTCATCTCAGATTTTACACCATAGCTTTGAGAAGGTGAGGTGGAAGTAGCGTATTCTTG
CTTTCTCGCCACCTTGTCTGGGTGCAGGCTTCTGCCCCGAAAGATCTCAGTTGAAAGGCT
TCTGGCAATTTCTTGCTCTATTTGGGGACCCAAGGAAAAGTTGTTCTGGGCTAATAGAGG
GAGAGGGCCGCGGGGGGATGCCTTCTCGGGTTTAATTCTTTCCGTGGGAAGGAACTGTTG
AGTCTACTTGCTTTAGAAATAGGAAGCTTGAGATTTTATGTTTATATGAGTTGATGTTAC
GGTTAAAACTTACACGATTTTGTAAGGTAGGAGTTTGCCAGGTGTTACAGGTAAAAGGGT
AATCAAGTAAAGCAAGATCACGTGGCTGAGAGTTTTCTGATGGTCCACGTTGAGTCTATG
AACGAGATTGGTTATAATGGCACAAGTTACAAGCATATTGTCCCTGCTGTCTGAATGAAT
GAGGTTTTGCACATATAAATACAAATGGCAGCCCAAAAACCCTTCAGTGAAGAGATGATG
ACGAGTCTGATTGGAGGTGTTATCTTTGTCCAGGTGGCTTACTCTGTGCTGCGTTCTGTG
GGGCAGGTTTAAGGATCCTGGGTCAAAGTGACTTCCTTAAGATGACCAAGAGGCATTTGT
CTGAGAAGGGTTGTTACTTCCTGTTGGAAAAAAGGTTGATGGGTCATTTGTTGGAGGCAC
TGAATTTTAACGAAGGTTATGTTATGCAGGGGGAAGTGAGCCTTGCATCCATGTCCTAAT
TTTGAACTTTGCTTTTTGGTTAGTTTGTTGCTGATGGCATCTTCAAAGCTGAGCTCAATG
AATTTCTCACTCGGGAGCTGGCTGAAGATGGTTACTCTGGAGTTGAAGTTCGAGTTACAC
CAACCAGGACAGAAATCATCATCTTAGCCACCAGGTAAAAACTCATTTGACTGGCCATCG
ACGATTTAAGCTTAAGGGAACAACCAATGACTTTGGCTTTAATCAATGTAATTGGTTTTT
AAATCTAACGCTGTAGTTCTTGTCCAGAGTTTAAACATGCTTATGGGAAATGTGTGTTTA
GTGCCACATATATGCAAGATTTAAAGCTGCACCCGGAATTTTGCGAGAGCTGTGAGCTGT
CACTCTTTTTCCCCAGGACGCAGAACGTTCTTGGTGAGAAGGGCCGGCGGATCCGGGAAT
TGACTGCTGTAGTTCAGAAGAGATTTGGCTTCCCTGAGGGCAGTGTAGAGGTGAGTAGTC
CTGGCTTATGCCAAAGATTACTGTGGACTTGAAATGGCTCTTCTAAAAAACTGTCACCAT
CACCTTTAAGACTTTATAATCCAGTTGAGTAGTATGAATGGGTTGGTATTTTTGATGAAG
TTCTCTTAATGAGCACTCGGTTTAATTTCTCATGATTATTCTGCTAATTTCTGGTGGTTA
AAGGATTTTATGTTCAACTCGGATATATACTGGAACCCTGATGTAGTGGTTAAGAGCTGT
GGCTGCAAACCAAAAGGTCAGCTGCTCCTTGGAAACTCTGTGGGGGCAGTTCTACTCTGT
TCTAAGTCAGAATTGACTAGACGACAATGGGAGTTTGGGTATTCTGCTTATTTCTGGTAG
TTAAAGGATTTTACATTCAACTCAGGTATATACTTGGGGGTCATATGAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved