Loxodonta_africana Locus Mono:93:SNORA70
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:93:SNORA70
Loxodonta_africana
Mono:93:SNORA70
GeneScaffold_3507
SNORA70
1001..1132
2132
AAACTCTTCCATTCTTCTGTCTGAAGATATAGACCTGGTTGCCTGTTCTCCAGAAGCAT
GGTATAATTAGGCCTAAGAGGAGTCCCACCACCCAGAAGGAAGGTTTTCTACTAATTAAC
CTGTTTTTAAATCCTGTTTCTCAGCTGTTCCCCTACTACCACACCTACTGTCCCCAAATC
TTAAGCTTCTGGAGAGAATAACTCTTGGTCTTAAGTTGGAGTAGGTGAAAGGTGAGCAGG
CCTGGGGAGAGGAGCTGGTAACCTCTCTATATATGGACTTTCAGCTCCACACTGTAGCCC
CACCTTCAAAAAACTTGTGTCTCCCAGTTCTGAGACTTTCTGGATCTTCTCTCAACTTAG
CTTGATACTTATCAGCATTCCTTTCTACAGGGTTTTCTGGTCCCTCAGCTAAATCAGCTG
CTGTTCCTCCATTTGCTTGTTATCTTCCAAATATTTGTTGAAATCTTTCATCTGCAATTG
TGTGTTAGTCTAGGTCCTTGAAGAGCCTAATGTACAAAGATTTTATTAGAGAACTGCCTG
TGTTAGAGAAAATGGGGAGTGAACTAGAAAAGACAGGGAGAGTGATGGCCCGAGGTGCTA
GTGAAGGAGAGAGGGAAGAAAGGTTGGATAGAAGCATGCTAGACTACAGTGTGGTCTAAG
GAAAGCTCAGCAAGGCTGTTCTTAAGCCAAAGTTGATAACTGGGGGAATCCGTTGTGTTC
CGGGAGTAGGACTGCCTTAGGTTCCCTGCCAGTGCTCAGCTGTGGACTGGGAGCAGCCCC
AGGCAGCATGGCCCAGACCCAAACTCACCTGTGGATTTTAGGTGGATTTCAGAGTCCAGC
CCCTGGAGACCTTGATCAGTTACACTCCCATAGTAGGAGGTCTGAGCGTGCTCATGGCAG
CCACAAATGGTTTCGTCTCCCATTCCCTTTATCCTTTGGGTATATTCCTTTTGTTTCGGG
GAGGGGATGTATTATTTTTAAAAAAAAAAAAACTCTTTATTCTGCAGCCAATTAAGCCAA
CTGTCCTCTTTTCCTGTGGGGCCTGGTGTCCAATGGCTGCAAACAGCAGCAACCTCAGTA
GTTTATGCAGTCTGTTTCACATACAGGTTCCCTAAGGGACATTGGAGACAGCCCTGTCCT
GTTCTTTCATGTCTCTGACCTCCCTAATCACTGCTATCCCTAATCTAGGCCCCAGATGGC
TATGCAAGGTGCATTTGGAAAATCCTAGGGTGCAGTGGCCAAGTCATCATGTCCATCTGC
ACCAAGCTTCAAAACAAGGAGCATGTGATTAAGGCCCTATACAGGGCCAAGTTCAGGTTC
TCTGGGTGCCAGAAACTCCACATCTCCAAGAAGTGGGACTTTACCAAGTTTAATGCTGAC
AAGTTTGAAGACATGGTGGCTGAGAAGTGCCTCATCCTGGATGGTTGTGGAGCCAAATTC
ATCCCCAATCATGGCCCCTTGGACAAGTGGCGGACCCTGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTCTTTTTTTCTCCAGAATTTCTGTGATGTGTTTATACCTCCTAAAAAA
TTTTAAAAAAGAAGGGAAGAGGTGATCAGAAGTGTCATATGCTGAAAGCTGGAGGAGGAT
AGAGACAGAGAAAAGGCTGTGTGACTTGCTAATTAGGAGGTCATTGTTGAACTTATTGCT
GATTCCACAGTTGTGGGTGTGAAAGCTAGCTTGAAAGAGACTGGAGTGGGTAGGTGTAGA
CAGCTCTGTTAAGGAGTCTGGTGGTAATGGAAGGAAGAAGAAGAGAGTTAACCAGCTGGA
TAATGGAAAGGGTCTTTTTAGGCTAGAGAGATTCTAAAAAAGTTCATTCCCATTGCCGTC
AAGTCTATTCCGACTCATAGTGACCCTGTAGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved