Loxodonta_africana Locus Mono:23:SNORD65
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:23:SNORD65
Loxodonta_africana
Mono:23:SNORD65
scaffold_43589
SNORD65
1001..1074
2074
CTCTCTCCTCTCTCTCTCATGTTTGGCTTTCTCTTCCTGATTTACATAGCAGAAAATGG
TCACCGTGCCCTGCCAGTTTCAAGTGCCAACAGGAACTGCCCAAAGTTTCCATGACCCAG
TTCCAAACATGATATTCCAAGCTTGGACCAGGCATTCACACAAGTCCAGTCAGCTGTGGC
CAGGACGGGGCTGCTACCCATCAGGAGACTGGGAGCAGATCAACTGAGGAGCTGAGTGGG
GCAGGGAGGCCCTTAGGACATATGTCCCCACAAATGCCTGAGCACAGTGTTGCTGTGTTC
TCATTGCCCTTAACCCAACCCAGGCTTTTCTCCTCTAGGCGTGCAGAAAAAGCTTCTTTC
CAACCCTCTCTGGTCTCTGGATAAGCCGGCCACTTCCCAGAAAGGCTCTGGGACTCTAGG
CCAGGTGACATCCAAACTTCTTCTTGACACTTGTTTCACACATTTATTTTTTCTCTTCCA
AAGATCGGAAAGTCAAAGACGAGGCAAACTGTCCTGGGCCTTCATGGCTCCTGGTCTTGG
GGACAGAGGTAGACATGTAAATCTGTTGCTCAGAGTTCAGTCAGACTGCAGCTTAGCATG
CTGCCTCTCGTCTGCCTGGGTAGAACCTGAGTATGTCAAACACCTGGGGGAAGACATCAC
CAGCTACAAACTGGCAAGAGAAGTCCTGTAGACAGGTAGATTCTGGACATACAAGATAGA
AGCAAGCGCAAGGTTGAGAAGTACTGACCCTAGCCAAGGAATAGGAACCAGAGCGGATAG
AATGAAGAAACCTGGCTAAGACACATGGGCAAGAATTTACCAAGAATTCTTTTAAAAGTA
GACAGTTCATGAGGCTGTCAAAGTAAATACACAACAGCTAAGAGTAAACAAGACTTGATA
GCACCAGAGCCAGGAAGAGGCCCGAGGGGTCTGGAGAGAGTCAGATAAACCAAGTCAGGC
TTAGAAAGTGAACCGTATCTCACTTAAGGTTCACTTTTTGCCCTTAGAAGAATTTATTTA
TTTATTTAAAAATATAATTACTTTTTGGTTTATTTTTCCAAATAATTAAATTTCTTTATG
AAAATTTCTGGCAAATATATGTATATCCTTGATTATGTATTTAATTACTTTTCTGTGTGG
AAGAAAACTTAGCTCTATTCATCTCCGTATTTCACCACCAACAACTTGGTGACCGCCACC
AGTAGCGGAAGGCACAGGAAGAATGCCTGGCCTTCCAACTGTTGCAGCCACGGTGTAAGC
CTTGCAGAAGGAATGGGTCCCCTTTTCACATTAGTTGCACTAGTACACTTATCTACCTAC
CTATCAGTTGTCATCAAGTTGATTTCAGCTCATGGCAACCCCATGTGTATCAGAGTAGAA
CTGTGTTCCATAGAGGTTTTTTTTTTAATTGTATTTTAGATAAAGGTTTTTAGAACAAAT
TAGCTTCTTATTAAACAGTTAGTACACATATTGTTTTATGACATTGGTTAACACCCCCAT
GACATGTCAGCACTCTCCCTTCTCAACTTTGGGTTCCCTAGTACCAGCTTTCCTGTGCCT
TCCTGCCTCTAAGTCCTTGCCCCTGGCCTGGTGTGCCCCTTCAGTCTCCTTTTGCTTTAT
GGGCCTCTCTAATCTTTGGCTGAAGGGTGAACCTCAGGTGTGATTTCATTACTGAGCTAA
AAAGGGTGTCCAGGGGCCATACTCCCTGGGTTTCTCCAGTCCCTGTCAGGCCAGTAAGTT
TGGTCTTTTTTTTGTGAGTTAGAATTTTGTTCTACATTTTTCTCCAGCTCTGGCTGGGAC
CCTGTAATGTGATCCCTGTCAGAGGAGTCACTGGTGGTAGCTGGACACCATCTAGTTGGA
CTGGACTCAGCCTGGTGGAGGCCGTGGTAGTTGTGACCATAGAATTTTCAGTGGCTGATT
TTTGGGAAGTAGATTGCCAGGCCTTTCTTCAGAGGCACCTCTGGGTAGACTTGAGCCTCC
AACCTTTTGGTTAGCAGCCAAGCATGTTAACTGTTTACACCATCCAAAAAAACCAAAAAA
ACTCGTTCCTGTCAAGTCAATTTCCACTCATGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved