Loxodonta_africana Locus Mono:9:SNORD45
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:9:SNORD45
Loxodonta_africana
Mono:9:SNORD45
scaffold_5986
SNORD45
1001..1083
2083
AAGAGAGTAGCTTTTGCGTAGTAGACAAGGTGCCTTGTAAATCAGTTTCTATAATTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCTTCTGCCCAGATTTGTGTTTTGAAGCA
CTGAATAGGTTGCTAGTTTTGTAGTTATGGTAATGCTTTAAGGTCAGTGATGTGTTGGCA
TGTATTATCTGAATTTACTGCTGATGTGTAATGACACTTAGCTCTAGAATTACGCTGAGA
CCTTGAAAAAGTTTTACCATAAAATAGTGAACTATGAATAGTTTTCTCTGGGACAGCCTT
TGAGAAAAATAATAAACTCAGCTGAAAGTAAATACTCTTTCCTAATGCCCTACTAGCAAA
CAGTTCTCTTCCTACCATCTTTGGGAGCATCCAGTATTGGTGAATTCCAGACTTAGGCCG
TTAGGTTGTTCCCTCCAACCTTGGAGTTAATACTATTTAGTAGCAGTGCACGGAGTTATG
GCCATGAGTGCTTTTTTCCATAGATGATTAAAGGGACAGGGCTTGACATTCTCCTGTCTT
TTATCTACTTCTGCTCACCCTTCCCCCTTTTAACCCCAATTTTGGGCTTGCAGCATACTA
AGAAACCCAAACTCGCTGCCATCTAGTTGATATCCCCCTCATAGCCAGCGATCCTATAGG
ACAGGGTAGCACTGCCCCATAGGGTTTCCCAAGGCTGTGAATCTTTACAGAAGCAGACTG
CCACATCTCCCATGAAGCAGCTGGTGGGTTGGAACCACTGAACTTTTGGCTAGCAGCTGA
GCATTTAAACCACTGTACCACCAGGGCTCCTACTAAGAACCAGCATGATTGAAAACCTCA
AAATGTGATGCATTGATGACTGCAGCAATTTCTGGACTCTAGAGATTTTCATGTTTCCTT
GTCTTATCCCCTGTATTACCTTGAACAGTTATCTTGAGTGTTGTGGGCATTTTGGTTTCT
AGAAAGGTAGATATGTAATTTACTAATAGATAATAGGCTATGTAGGTAATGAAAGAATGG
GCATGTATTAAATACAATGTATGGACATTTTCTTCCCAAGCAGAGTTAACTTATTTCAAC
TGTGGTTGGCTCCTGGGTGAGACCAAACTCTTAGGACAAATTGTCAGCTGCAGATAAATT
TTATAATATGCATCTCAGATAATACTTGATTTTTCTGATTAATAGATCATGTTTGAAAGT
GGCACCTAAATTTCAGAGCCACAAATACAAACTAACTATATATT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved