Loxodonta_africana Locus Mono:40:SNORA26
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:40:SNORA26
Loxodonta_africana
Mono:40:SNORA26
scaffold_78972
SNORA26
1001..1122
2122
GGCACATTAGCCTGAAAGGACAAAATCCAATAGGGTCAAGGCCTGGGGAGGTGCTAAAG
AATGCGGCTCACGAGGAGCGCTCCCAGACATTCCCAAAACGACGCTGGCTGCAGGGTCTG
CCAGTCTTTGAGCCACACCAATAGCCAGCGCGGCCAGGGCGCGCGAGGACCGCAGGCAGC
CAATGGCGGGGCCCGGTCCTCCCTGCCCCGCCTCAGCCTCCCCACGATTGGCTGTCTGTC
CGGCGGCCTCGGGCCACGCCCCAGCGCCCTGGGCTTTTCCTGTCTGCTCTGCTTGTCTGT
CTGTCCCTGGAGCTGGCGGTGAGTGTCGTTCGGTCCTGCGCGGCGGGGAGGGCGGCCCCG
GGTGGGGTGGGCTCGCCCCGCGTCCCCTCGAGCTTTGCCCGCCCGGAGCCCCGCTGCTCC
CGGCGGCCAGAACGCAGGGGTAGAGCAGCCAGCGCTCGGCGGCCCGGGGGTCTGGCGGCC
GTGCCCGTCCCGGGGCCGCGCGAGGCACAGGCGCCGCGCCCAGGCCCGGAGGCTCCCGCC
GGCGGCGCGGCGCGGCGACAAGGTTGCGCTTTGCTTCCCCAGGCCGGATCCGCGGCTACT
TTGTGGCGGAGTCGGGGCCCGGCTCACCCGCGGCGGCAGGAGTCGGTCTGGCCGACCTCG
GGCTCCGGGAGTTTGTCGCAAACGTCTGCGGAGGTGCAGCGGCCTGAGCTCTGAGCGCAG
GTAGGTCCCTGACCCTGAGCGAAGCGAACCGACCAGGCTGCGAGCGTGAGCACGTGGCTG
ATGGCGGCGGGAGGGTCCCAGGCACGTGTTTGGTGCCAAGGCCCGAATCCGGCTCTTCCT
TCGGGAAAAGGACGTTTATACACACACGGCTCCACCCAACAGAAAAGCTGTTTCCACTGC
GATTTGAGAGCCTGAGGTCCACGGGGTTCTGATGAGAGGGGAGTGTAGGAAACAGTGAAC
GGGAGAACCTCATAAGCACAAATGCAAAGTCGCCCTTTCCTGTGCCCTTTTAAGGTTGCT
GCAGTGCTTTAAGAGGCTAACACAGAAGGGTAAAGTAAGACTCTATAAAACCCAGAGAAG
AGACTGGAGAACTCCTCTTTGGATCCTGTCTGGAGTCACAGCTGAACCAGAAGAAAATTT
CCGTAGAATTTAAGCACCTGTCTTACTACATTCTTAAACAGCACTTAGCACAAGTGGTAA
ACTTTGTTTTGATGACTTAGGCAAAGTGTTGGCAGTTGACGCATGCTAGACTTCTCTGGA
TAGACTAGAGAGTTTTCTAGTAGATAAAGAGAATTTGGAAGCCTTGTTTTTTTTTCTTTT
TTAAGGTAGAAAAATATAATGTTTCAAAGAATAAACTTTGGGTAATCATCATATGTGTTT
ATGAACTAAAACTTTTTTTTAATTTCCTTTAGGTAGAAAACCACCAAGTTTTTAAACTGC
AACATCTGCTGTGCTTTGCTGGCTCTCCATGGACATTTCAATATGCTGTGTTATGGAGTG
GTGTCTGTCTGGCTGTAGTGTCCAGCATCAATACACTGTAGGGTCAGCGCAGAGGTAGTT
TATTGTATTGGTCACTAAGCTGTGTGCTGAGTCTTGTGGTAGGTTCCTTACATTCGTCTT
TCTATTTAATACACGTGGCATTTTACACATGAATAAACTCAAAAGGTAGATAACTTGCTA
AGATTATAACAGTACTGAAAAAGAGCAAGGCTTAGAACAGGGTATCTTGTATGCTACCTT
TCACATAAAAAAATTCACATATATATCTGCTTATTTTGCAAATAGAAATTCAGGAAGGAT
AAACAGCAGCTAATGAAAGTGGTTACATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved