Loxodonta_africana Locus Mono:74:SNORD20
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:74:SNORD20
Loxodonta_africana
Mono:74:SNORD20
GeneScaffold_2123
SNORD20
1001..1082
2082
TGTGCTTTTTAAGTTGATTGATTGTAATTAGATGGGGATGAAGGTCAGAGGAGGGTGAT
AGCCAGATTTTGTAGTAATTCATTTTCTTAAATAAGGGCTATGTGAAATCATTTTGTGTT
GAAGCACAGTAGGTCAATTTAGCTTCCTTTGCAGATTTATTTTATGCTTTAACATAGATC
TGTAGATTTTAAAATTAGAGTATTCTGGGAGGATGTACTAGTTCAGTAGTAGGGTGCACA
CATAAACAGGAACAGAGGGGAGTGGCGCATAGCAGTATATGACCGGTGTGGCCTCACTTG
CCTCAGCGTTGGCATGTTCGTTATCCCAGCGCACAAATGTTCTTAAGAACAAGGTGTCCG
CCATGACTAAAATTGGGAACCACTGTTTCTCCTCTTAAGAACGTGGCATCTCTGTTTGTA
GGTGAATCCAAAACTCTGGTCTTAAGCAACCTCTCCTACAACGCGACAGAAGAAACTCTT
CAGGAAGTATTTGAGAAGGCAACAGCTATCAAGGTGCCCCAGAACCAAAACGGCAAATCT
AAAGGGTAAAATCGTTACTATCTTGTCAGTTATGGACTGTTACATCTTAAATCAAAAAAA
AAAAAAAAAAAAAGTAAAATCAGGTTTTTCTGACTGTCAACAGAAGCTGAATTTTTTTTA
AGCTACAATTTTTAAGTTGGTTGAGGTTCAGCATGTAAGTAAGAGGAGTCTGCCTGGTAA
CTTATTCTAAATATTAACACTTCATCTTTAGGTATGCGTTTATAGAATTTGCTTCATTTG
AAGATGCTAAAGAAGCTTTAAATTCTTGTAATAAAAGAGAAATCGAGGGCAGAGCAATCA
GGTTGGAGTTGCAAGGATCCAGGGGATCACCTAATGCAAGAAGCCGTAAGTTACATCCAC
TTCACAGCTCCTCAGTACTGTGCTTGGAGTTCCCGTTCAGGCTGGTGTTCTGCTTTCCCC
CATATCTTCAGGTCTTTCAGTCGCTACTGAGTGAACAGTACTGGACATGATGACTGATTT
TATCTGAGAAATAATTGATGAACCTCAAGAAAATTTCCTCTAGATAGTCAAGTTCTGACC
CAGATGTGTTTGACTCAGCAGCACCTTTACCATGATTAGGTGCCCCCGATGGTGGGTTGT
AATTGGCTGTGTTAAGATGACTTTTGACTTGTTTTACGTTGCTTCTCCTGCTTTCCGTAA
AACATCTGAGATGAAGAATCTTAACAGCTGTCTAAACTCTAGTTGCCAACAGAATCAAGG
CCCTTTCCTTTTAATTAGCGGTAGTTAACTAAGATGGCTATTTAACTGCTTTTGTAAGCC
CCTTTTTGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved