Loxodonta_africana Locus Mono:2:SNORA9
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:2:SNORA9
Loxodonta_africana
Mono:2:SNORA9
scaffold_3518
SNORA9
1001..1136
2136
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNAGTACTCCTCAGTGCCTTTAGTATGCTGATTATGTCATGAGCCTCT
CAGAAGAGGACATAATGAATAGCATTTCCCAAATTTATTTGTCCTAGGAACCCTTTTTTC
ACACTGAATGTCTCTAGGAACCAGTGTCTCTCAGAGCTCACTCTAGGAAATACCCAGCTA
TCATCTTTTGTTGATAACATTTAAAATTTTTTTCTAAACAGAAATTCATGATTTAACCAA
GCAAGAGCTCATAATATACTTGGCCATTAGAGTCTATAAGTGGCGTGTATGGAGATCAGC
AAAAGGAGATATTTAGCTGGTGGCTAGAAATCTAGTTGAGAAGTTGAAATGAGTTTTTTA
GAAGACAAGAAGAAATCTAGATGTAGATACCTAGCATTTACCAGGCCTCTTAAAAACATC
TTGAACCTGCCCTATTTTTGTTTTGTATTGCTATCTGGGCAATATAAATAAGGTCTGTGA
TGTCATCCCCCATCAGCATTAACCCAACCATATGTGGGAAAAGTTTATGACTTTGCCAGA
GGGACACCCTCCCCCTACCCAACACTGAACTATGCTTTTGAAATTAAAGAAAAAGAAATC
CAGATTTATGTGACATTCTCTATTGCTCTAAATCCACTAGGTCCTGTTGACTAGAGTACA
GAGAGTTGAGTTCATGTGTTTTCCCCAGAATTCAAAGCTAAGTGAGATTATGGGATCCCG
GTTTTTCAGCCCTGTCTGTATATCAGAATTGCCTTTGGAACTTGGAGCTGCTGGCCTGGG
GCCTGAGTGAGGTTCTGGGCATCTATTAAGAAGAAGTTGCCTTGCAAGCCTCCAGCATGC
TTGGGTCTGGAGTGGCCCTGTGCATTCCTCCAGTGCTTGCCAAAAACAGTTTTGAAACGG
TTTGAGGTCTCGCTCTACATCATCTACAGAGCAAGGATATAGAAATTTCAGACAGTTGGG
AGAAGAACATTTGCTGAGGGGGCTGGTTCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved