Loxodonta_africana Locus Mono:46:SNORA13
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:46:SNORA13
Loxodonta_africana
Mono:46:SNORA13
scaffold_124819
SNORA13
1001..1134
1151
CAATTATTATTTTTTCAAGCCTTTGTGCTGTCCATTCACTTTTGCAAGCTTGCCGATGT
GGTGTCAAAAAAGCTGCAAATTAAACTCTTTGCTGCCATTTTCTGCCCTTGAATTTGGTG
TCTTTGGTGTTGGGGCTGCATCAGATACAGCTTGTACCTTTACGGTAGTTTGTTTACACA
GCTGACTTTTAGTCTGCAAAAATTAAATGTATGGTTTTTCTCAAGTAGTTTAAAAAATTT
TTTTTTTTTCCTCAAGAAAAGTAAGGTGGGGAATAGAAGAAGAATCTCAGGGGTTGGCTG
AGAAGATTCGAAGGAAGAGAGTAACTTGGAAAACCAGCTGCCATAACAGTTGGGATGGAA
TGAGAAAGGGCACAACGTAAGGAGCTGAGCTTTCAGGGGTGCTGTGGTGGGGGTGGGGAG
CTGTAGGGGGCTTGGGGTAGCTGTCCTCTGAGATGGGAATAGTCTTAAAGCCAGAGAATA
TATCAGTTTGGTCTGCTAGCTTTTACTGTCCTGTCTTCCCCATTTCCCTTCCACTGGAGT
CTTCCTTTTGATTTATTTTACTTTAGATTTTTATGTATTATGGGCTGTATTTTTTTTAGG
TTAATACCTGCAAGTTTATTTCTTGCTCAGTGTTTCAGTTATTGATTTCTGCACTAGTGG
CTTCAAACACCTAGTGGCTTAAACAATGAGCTGATAATAAACTCTTCATATGCATGATTT
CTTTTAATCCTTGCACACACTTGGAGCACTTGGTATTTTTATTCTCATTCACAACTGAGG
AAGTTTTGGCAGGCTGAGGTCACACAATAAGCCAGTGGCAGGTAGGAAGTGGCACCTGGT
TCTCTCCAGTGGCATCCTCCCTGTTCTCAGTCCAGCATGCTAAAACCACCAGTCTGTCCC
TGCTGTCGTGACTGATGTGGCCACAACTATGACTATGCCCACATAAGGATGTGTTTGCTG
TCTGTGGCCATAATTCGCTTCTTGTTAGTAAGTTGTGGAAAAATGGTTATGTAGAAATAA
CACAAATAACACCTCCCGGTGTCAACCCAGCCCCCATGGGGGACAAGATGCTTAGCAACT
CTTTCAAAGTATCCAAGACAAAATTTGACCTTTAAGCAGTTTCTCCGTTTAGAGTTAAAT
TTGTCTTCAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved