Loxodonta_africana Locus Mono:10:SNORD64
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:10:SNORD64
Loxodonta_africana
Mono:10:SNORD64
scaffold_7252
SNORD64
1001..1071
2071
GTGTGTAAATGGGATTTTTATATACCAAGTCTCATTTAAATTCAGCAAGGTAACTTACT
ATTTCAAGGACCTCTAGGGTAAAACATTTCGAAGGCAAAAAAAAAATTCAACAATGAGGA
CAACCATCTCTTGAATTGTTTATCTTACAAATTCAAATTTTTGGTGATCATATCTGATAG
AAATAAGGCCCACTTGCAAATCAAATGCTGAGCTTGGTATAACTGCCAGTATTCCTCAAA
CTGTCCGCAGTGATGGGGGAGATGGGGTGGTGGGCAGGCTGCCCCACATCCTGAAAGGAG
CCTGTAACTAGGCAGACTCGCATATGCAAATCAGGCTCCAAAGTTCTCCCTCAGCAGTTT
ACACGTCATGCAAAACTGGCCTTCATACTAGAAGTAATGAATCTCAGATCTCCTTAACGG
AGGGAAACTAAGACAGGCTCTTGCCCTTAGGGAAAGAAGATATGTATCCACTTGACAAAT
GACCTAAGCAAGACTGAACAGGATGGTCTGGAAAGTAGTACTGGCAGAAAGGGAGACAGG
CCCAGGTCTTCTGCCTCCCAGTTCTATCCAGGTAAACTTCAACAACTGGAGTCTTACACA
AAACAACAGAGGGTAGTTCATACAACTCTTCGCTAGCACAGTAGGGGTATGGTCAGTCTA
AACTGTATTAAATGTCACTACATCCAGCTATCTTAGAGATTCCAAGAGCACAGGAACATG
TTAACAACAGAGAGATGGGCAGTAAGTTAGCAATGTCATAATGGGGGGTGAATGTCATAC
ATACATGGTGCAATGATCATACCAGCTTAGAAAACGAGACTGGAACCTGTAAAATATGTG
TATTGGGATACACACGTGTCGTTTCTATAGAAGGTAGATAAAGTAATTGATTTTGCATGA
AAGATCCAGAAAAAAGAACAATTGGAATGTTTCAAATGGAACAACAAAAAGACAAACAAC
TCGATTAAAAGAAAAATGGACAAAAGACTTGAATAGACATTTCACCAAAGAAGACATACA
AATAGCCAATGAGCATTATGAAAAGATGCTCAATGTGTTTAGTCATTGGTGAGATGGAAA
TCAAAACCACAATGAGATACCACTTCACCTCCTCCAGAATAAAAAAAATAATCTATGATT
AAAAAAAGAAAAATAACAAGAGTTGGTGAGACTATAAAGAAATTGGAACTCTCATGCGTC
GCTGGTGCGATTGTAAGATGGTACGGCACTGTGGAAGAGTCTGGAGTCCTCAAAAAGTAA
ACACACACTACCATATGACCAGCATCCCATCTACATCTATATCAAAAGACTGAAGCAGAA
AGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTACAACAGAATATTACTCATCTGTAAAGAGAAATAA
AGTCCTAATACATGGTACAAAGTGGATAAACCTTGACAACACTATGCTGAGTGAAAAAAG
TCAGTCACACACACACACACACAAAAACCAAACAAATATTGTATGATCCCGCTTATAGGC
ATATCTAGAATAGGCAAATGCACAGACACGGTTTATTAGAGATTCCTAGTGTTGAGAGGG
AGCCCTGATAGCACAGTGGTTAAGTGCTCTGCCACTAAGCAAGGGGCCGGCTGTTTGAAC
CCCCCAGCTGCTCTGTGGGAGAAAGGTGTGGCAGTCTGCTTCTGTGAAGATTAACAGCCT
TGGAAACCCTATGGGCCACTACCACTCTGTCCCATACAGTGGCTGTGAGTTGGAATCGAC
CCCATGGCATGAGTTCCAATGGTAAGAGTTGGAAGGTTCTAGAAGTAAATGGGGAGTCAT
TGCGTGGAGGTCACCGAGCGTCTGTTAATGGTGGGGGACAACTGGGAAACTGTGGCAACG
GCTGCACAGCCTGATCGCTGGGATCAATGTCACTGAATTGTACGTGGGAAAAAAGTTGAG
CTGGCAAATATTTTATTATATATACATTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved