Loxodonta_africana Locus Mono:91:SNORA65
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:91:SNORA65
Loxodonta_africana
Mono:91:SNORA65
GeneScaffold_3393
SNORA65
1001..1130
2130
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCCCAGGCTAGTAGACACCTGTCAGATTGTGAAGATTGCTTGAGAATGTACAGCAGGCCC
AGTGTCTGGCTCAGGAACTGAGATCTGAAGTGCATGGCACTATTGCTTGTGTTCACTGGA
GGTGGAGTAGGGCTTATTATTCATATCAAGAATCTCTGCTGCAGATTGAAGTGGTGCCCT
CCGCCTCTGCCCTGATCATCAAAGCCCTCAAAGAACCACCCAGAGACAGAAAGAAGCAGA
AAAACAGTGAGTTCCTTTTTCACTGGTAATCTGTTCCACTGATGGTTTGTGATTGATGGT
TGTGTAGCCAGTGTTTGATAAAGGGCTGCATATTTTCCCTTTGATGAAACCTGGGGATTG
GGTGATTCATTGAAAGTTGTTACAGAGCCAGGCACTACCAAAAGGTGCCACGTAGCTTTT
CCCAGCCCCTGGTGCGGGGCCCGTCACACTTACAGTACTTGAGAGGGAAAGAGGTGTGAG
GATCTTTGCTTGTCTTGGGCAGTTAAGGTGGGTTGAGGCAACTGAGTGATGGACTGGTAA
TCAGGAAGTAACTGGCTTAACCACAGTAACTTGAGTCTGTTTCCTCAGCTCTAAAATAGG
GATATGTCAGGTTAACGAAGACTTGGTTTTGCCCGTAGCCACCCGCCACTGCACCTGATC
AGTTCTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGATAGTAAACCCCAGCTTAGGAAA
CAGAGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGAACAGCCTAGGGAAGG
ATTGAGGACATTATGTAGTTTGTTCTGGCCTTGAGTTGTTAACAGCTTTTGTGTTTTCCT
TTCTGCAGTTAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved