Loxodonta_africana Locus Poly:12:SNORD113
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:12:SNORD113
Loxodonta_africana
Poly:12:SNORD113
scaffold_34615
SNORD113, SNORD113
1001..1072, 3118..3200
4200
TCCAATTCCATTTAAAAAAAAAAAAAGAGAAAGAGAATCTAGACTCTTAGCTATGTGGG
TGGGGCTTAATAGACAGAATTTGAAACAATTAATAAGAAATAAGTTCTTTAAAAAAAATT
CTTTTTTTGCTGGGAATTATAGTTAGCTGTTGTCATTATATTAGATAAATTGATAATTAA
ATATGTCATTACTAAAAAGAAGGCCGTTCTTGGGCCAATGATGGAAACGTGATGAAAATA
GAGGCTTATGATAAAATTAGTAAAGGAGGACTAAGGCCCCTTAAGGTATTTACATCTACC
CTGCTTCGATATTTTAGGATCTGCGTTTTACTCCACAGGATCAGTACACCAAACCTGGCC
TATTCATTATTCGGTGATGAAGATCTCTGCAGTCACTCTGTGGATGAGGAGCAGAGGGAC
TTAAGTAAGTAAGAGGGTTCGTGTTCTTGGTTTGGAAGGGGTTATTCATGTGGTCCATGG
AACTACCTCAATGGAATAAATGACTGCAAACATGAAATCAAAGAATACCATGCGTGGAGC
AATGCTGGGATTAAGATCAATCCATTTTAGTACAACCGAGATCCATTAAAAACAAAGTTG
GAGGGTGTTTCATTTGGTTTCACAGTTTGCCTAGTATTCTATTTTATTTTGTACCACAAT
TAAAAATATTCTGTACTGATAAAGTTCTAGGGTGTTAAATCGTTGAGGAGGGAGCCCTTA
GGAAGATGTAAAGTATTGTCAGTGTTCTAGTTGTGGGGTAAAGTGGTAGGTTCCTGGTTG
TTCATTGTACTGTCTTAAAAATGCAAAGACAGATAAGCAAGTAGCAGTGAACAACATGTG
ATGGACATGAAGTTTGTTGATTAGTCCATACATGCAATCACAGTCATGCATCTTGTTCTT
AGCATTCATGATTCATGGATGTTCGTTGTATTATAATTTATGCATCTAAGGATAAATCCA
GTCAGAAAAATATGAATGAAGAAGAAAAAAAGTGCCATGTCTTGACCAATGATGAGTATC
CTGGGGTGTCTGAATCTATGATTTTGATTAAACCCATTAACTCTGAGGTCTATTACGAGA
AGACATCTAGTTATTGTCTCTGTAGTAAAGGGACTTACGGTAGAAGATAAGAATATTCAG
GGTCTTGTTCTTGGGGTTTTGTATTCCTTGGTTATGGTTTTTGTTTCTTATTATAATGAA
GTAATGCATGAATAAAGAAAGAGATGAGGGAATGAATGAAGGCAAGGAAAGCCACCCATT
GTGAAATTATGAATTATTAATGGATTTCTGAAGCACTGAGGCCTAGTAAAATAAATAGAT
TAAGGTTTTTAACCCCTTTCACCAGGGAGCAGATAGATGTGTGCAAAATTAAACGTTGTC
ATTATGGATTGGCGATTGTTTATTTCATTTAGAAAAGGGCAAAATGTTTGCCCAAATAAT
TAAATAGCTAATTAAAACAGGGCAATCATGAATGGCAAGCATTCTCATGATGGGAATATG
TCACATGACAAGAGTTATGATTAATATAATTTATTATGGGCAATGAGCATATGATCAAAT
GTTCATATTATTCAGGGTTTGGGTCCAATGAATTATAATTATAATAATGACATATTATAA
TTATATATTATTATAAGTGAATGAATATGTTCATATCTTAGTTAAAATGTCACAAATTAA
ACACTAATGAAGAGCCTTGTTACGAAATAAGAATAATGATTACCCTGTTTTATACAACTG
ATATCCATATTTTAGAACATCGAGGCCTTTCCCCACTTTGGATAATGTACACATAGGCAC
TTGCACATAATAGTATTTCAGTTCTGGGTCGCTGTCCATTTTACCATTTCTTTACATCAT
GAACAAATGATAAAATTATTCCAGGAGTAATTAAATAAATGAATGAGTGAAAACATAAAG
TAGAGCCAAGCACAGGCCATTGTTAAGAATATTCTATGAAATAAGAATTTAAATTTATCT
AATCTGCAGAAGAAATGTCCATTAAAATGATGATGTAGACCTTACTCAGTAAAGTGTTTG
GACAGATATTTTTAATGATCATCCATCTTATTTGTGGGTCAGATTAGTGGATTCAATGGT
GTTCATTATATTGTTTAAAATGAAAATCAAATAATTGAGTAAGTAAAAAGTAGTGACATT
CTTGGGTCAATGAAATGAAGGAAGTTTTATATCTTCATTTGGTCTTAGTTCGTGTGTGGC
CTTCCTTGTCTTCATTCAAGTTTTATGTGCAGTCTGCTCTTGAACTGCATAAGTAATATT
CCTTAAAAATACCTAACCTTCTGCTTTTTCATTATTTTTAAAACCTGCCTTTCACCATGG
ACTTAACCTACCATAGCTGATTTAATCAATATGAAACAATGAAGATTGGCTGATACCTCT
GTGTTCAAGAAGCATAAATATTGATGTGAGTCACATTCAAAGTTTATGTTCTTGATTAAG
GGTATTTGTTCATGGGTTTTCACTGAAATATTCCAAAGTGGTAGATAACTACATACAATT
ATCAAAGTAATAAATAGCTACATCAAATTATAAAATTAAAGAATATCGTACATTGCCAAT
GATGGGAATATACTATGAACCTAGCATAATGATATTTTATTTAATTCTGTACAACTGATG
ACTCCTAAAAAACAAGATGGAAGGTGTTTCACCCATTTTCAGGGCTGTTTACTATTGGCT
TTTATATTTATATCACAGTTGATGTCAACATTTCTAACTTCAAAAGATCTACTTGAGAGG
GAGCACATTGGAAGATATTGTCAGTCGTCTTGGTCTAGGGAAAAATAGTGGCATCATGGT
TGCTTATTGTCCCATCTTTAAACTATATGCAGGTTAATGGAAGGAGGGGGCCCATATGGA
CCAGTGATGAGTAAAGGGTTGTTATGAAGAAGGCGTGTTGATTGATTCAGATGTGCCACA
CTGAGGACCATTGTGAAAAGAGAACTAATGTATGAGAAGTGAGCGTATGGGTAGGTATTA
GTAATATTCAAGGATCTTATTCTTGAGATATTGTGATCCATATGTGTTGATTGTATTATT
ATTGGATCAGGGAATGAATCCGTAAAGGGATAAAGGACTGAAGAAAAAGTGCAAAGTCTG
GACCAATGATGACTCCTAGGGTGGGGGTCGGGTCTGAATCTGACACTGTGATTAATCCCT
ATCTGGAACTCTGAGGTCCACTGTAAAAAGAGAAAAGCTAAGCTCTTTGCCAAATGAACT
CATCAATGGATAAAGAAATGTATAAATGAATGGAGACAAGGAGGGTCACATGTGGGCCAA
TTATGAAATTGTGTAATAAAACAAAGATTATTATTAATCCATATTCGAAACACTAATTTC
CATAAGATAAATATATCAAAGCCCTTTCCATAGGTCAGTCTAGACAGATGGACCTAAGAG
TCCATGTTGTTGCTTTGACTGGTTGGTTGGTTGCTTTAATTAGAAAAGGGAGGAAAGGTT
TACATAAATAAACACTTGCTTAAATAATTGCCTTATTATTTTTAAAAAATAATATTTTGT
GTTTTCAGTGGAAGTTGATGCAGCAAATTAGGTTCACATCTAACAGTTACTATACAAATT
GTTCAGTCGGACTAGTTATATTTTTCACTATGTGGCAACATTCTCATTAATTCCATTCTG
AATGTTGCCAGTCATCTGGTATCCCTGTCCCCTTACCCTTTCGTCTTTGCTTTAGACTAA
TTGATGACCATTTGGTCACATATGGATGATTTTTAAAGGTGTGCCATACTCACTGGTAAT
ATTCTTTATCTTAAGAGCCTATCTGTTATTTAGCTAAAAGGTGACCTTATGGGGTAGTTT
TGGTTCAAGGTTTATGGAGTATCTCTGGGTGATAGTTTCAGGGAGTCCTCTAGTCTCAAC
CAATTCAGTAGGTTTGGACTTTTTAAGAATTTGAGCTCTGTTTTATCAGGTTCCTTCTAT
TCTGGCCCTGATCAAAATGGTCCTTGGGTAGCAGGGCACCATCTAGTTCTTCTGGTCTCA
AGGTAGATGAGATCCTGATTCATGTAGACTGTCCTATAGACTTGTTTCTTCTCTGAGTCT
TTGGTTTCCCTTTTTTTTTTTGCTCCGGATGAGAAGAATCTGATAGTTGTATCGTAGATG
GCCACTTGGGAGCTTTTAAGTCTCCAGACACTAATCACCAAAATAGGATGTAGAACAGAA
A
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved