Loxodonta_africana Locus Mono:86:SNORA19
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Mono:86:SNORA19
Loxodonta_africana
Mono:86:SNORA19
GeneScaffold_4779
SNORA19
1001..1121
2121
TTAAAATGCTCAACAAAATTAATCAATAGATCAATTAATCACCAGGAGGTTTTAAAAGA
TCTCTGGATTTTGTTTCTTCTCTTCCTTCCTCTCTCTTTTCTTCCCTCATCCCATTTCTT
CCTTCTTTTGGTCTCAGTATCCATTCGCTGTTAGGCAATTATTTACCAGGCACCAACGTG
TATGCTTAGGGCTATAATATGGACTAAGGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAAGTGAATGAAACCCTGTACTTATCCTCGGTCATCATCCAGTGAGCAA
GCAACTTAAGCCTATGGAAGGGGTGTGCAGAGACAAGGTGTAAGGGAGCACCATACCTGG
TCCAGCTTCTCAGTGAATTCTGCGGGTCGAATAGTGTCGGCCTGGTCATAGTCCTTCCGC
AAGAGGAAGACAAGGCGGCAGTTATGGACATAGAGAGCGTAGTGATGCCGGTTCATTTCT
GAAAAGCAGAGAGAGGATTTGGGGAGTGACAGACTCTCTGTGTCAATTTCCCTGTGTCAG
TGGGGTCTTCCTGCCACATCACTTAAATCGGTTGCTACTGAGTTGACTCTGAATCGTGAT
GAGCCCACGTGTGTCGAAGAGTAGAATTGTGTTCCACAGGGTTTTCAGTGGCTGATTTTT
GGGAAGTAGATCACCAGACTTTTCTTCTAAGGTGCCTCAGAGTGGACTCAAACTTTCAAC
CTTTTGGTTAGCAGCCAAGTACGTTAGCCATTTGCACCACCCAGGGACTCCACATCAACC
GAGTTCACCTCAAAGACAAAACAAAGGAGTGAACATTCTCATTTTCTCTTTTATAATTAG
TTCTGATGAATGTTCAGGAACACACATGGTGGAGCTCACTGAAATGGGAGAGGCAGAATC
AAGAAAGTCCAAAGCAAAACTTCTGTCAAAAAGCCATTTGGGCGCACATTTCTTTGGCCT
ACTTCTTTTACATATGTGAGCGGTGTTATTTGTTATGTGCTATGCAAATTTTTTTTGTTT
ATGCAAATAGTTGAAGGTTAATTAGCAGTATAAAAAACAAAAATAACCAAACCCACTGCC
TTCGAGTCGATTCCAACTCCGAGGGACCCTATAGGACAGAGTAGAACTGCCTTATGGGGT
TGCCAAGGCTGTAATCTTTTCGGAAGCAGACTGTCATGTCTTTCTTCAGAGGAACAGCTG
ATGGCTTCAAACCACCAACCTTTTGGTTAGCACACCACCAGGGCCCCTCAGTTAGCAGTA
TAACTAAATAGTACTGCGGCCAATCTCCTTCAAATAAATAAAATGAAATTAATAATTAAT
TAAAAAACGTCAAATACTGAGATACTCAGATACTACATCAGACCCAGGATAAAAATTACT
TAAATTAAGTCTTTTTTTTTTTTTTTTTTTAAGTGCAAATGCTTCCAGAAGGGCTAAGAA
GGCTCACTGCCTATCACATCAGCCATTCTGGGCTCCTTTAATACAGTTGGCTTCTCCTAG
AATTCTGGACTTTTCTTTCATCAGGCTTGCTGATGGTACCCATAGACTACGTCTCCTTCC
TCTACCTAATATGGGATAAGTGGAGCTGCCTCACTTTTAGCAGCTGGACAGAGGGAACAG
ATTGATTTTTTTAGCATCAGACATAGCTCAGTAACTTTCCAAAGCAATGACTAACCACCC
CTTTCCCATATGCAAGCAGTCCATGAGACCCTTCCTTCCCCACTGGTATGAAAACTTCCT
TTCCTGTTTAGGGAATTTCGTGTCATGGGTCCCAGCCATGATGCCTGTAGCCACAGATAC
TACCCATTGGGCAGAGAGGAACTGCTCTTTGACCCATACTCACATTTTACTACATTGTAG
CATTTACTACCACCAGGTACGGGCTCCATAAATGCTGGCTGAATGAACAGGTGAAATGGA
GGGAGCATAAGTCTGAGATTTAGATAGACTTTGGGTTGAGCAGAGTCTCTAGGGCACCTT
GACAGAGTTCTTTAGACTCTCAGAGTCTCTGTTTCCTTGAATATATTACGGGAAGGCTGT
TGGATTATCCTAATGTATCATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved