Loxodonta_africana Locus Poly:31:SNORD22
snOPY snoRNA Orthological Gene Database
Loxodonta_africana Poly:31:SNORD22
Loxodonta_africana
Poly:31:SNORD22
GeneScaffold_5580
SNORD30, SNORD31, SNORD22
1001..1070, 1343..1410, 1684..1809
2809
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAAATACGGTATGTGCA
TGTGGCATATAGGGTGGGGAAAGGTGCTTTCTCAGGCTCTTCTAAATGATGACTTACATG
GAATCTCGTTCGGCTGATAACTTGCTGTTGAGACTCGGAAATCTGATTTTTCAGGAAATA
AGGGGTTGGGCAAGAACACTTTAACTGAGAGTGGGTGCATTGCTGACTGAGTCTTGTTTG
TTGTAGGTGCATCATCTTGCCTGGTGTCCTAGCAGTGATTTGAGGTAAGTGTTTTGCATA
AAGGAGCCCTGGTGGCTCCATTGTTAAAGTGCTCAGCTGCTAGTTGAAAGGTTGCCCGTT
CAAACCTTAATATAAAACATCTGTGCTTGGGTAGCTGTACCAAGACTGCCAGTCTAGTCC
AGAGTTTTACTGGCAACTGCCTGATCACCAGTGATGAGTTGAATACCGCCCCAGTCTGAT
CACTGTGACTGAAAGGTATTTCTGAGCTGTGAGCCTGCCATGCCAGTGACAAGTCCTAAC
AATAGCAAGTTAAGTGGGTTTTACTGTGGACGAGCTGGTAATCTCTGTAGATATTGAACA
CCTATACAGCGTATACGAGGGTGCTTTTCCTTTAAGCAACAGGAAGTCTTGGGATGATTG
AGAAACTTAATTCATCATCTCTTAATCTTTTTCAGGGAGACTAGAAGCCATGTATCTATT
CAGCCCCAGTCTGGGGTTAGAGGTGAGTAAACATGCGCTTCAGCAGGGCTAAGTAAAATT
CAGATCCCGATGAAGAAACATGTACACGTCTTACCTCCTGTCCTGGTCCCAGAGCCTGTA
AAGGTGAACCCACTGGGGCTGGCTGGGGGAGAGGAGGAGAGCTTGTTCCAGAAGGAACAG
TCTGAGGGATCAAGGGGATTTCTGTAGCTGGGCTGGGGCGGAGTGACCACCTGCTGAAAA
TCAGTCGTTCATTTTTTCAGGTCTCAGGAAAAGAACAAGGTGCATTTAAGTGGTAGGTGT
TTTGTTCAAACGTTTGTTCGGACTATGAACAAAAAAGTACCTGGAAGCAACCCTTTTAAC
GTTTTTCTTCTTTCCTCTGCAGGAACCAAAGTCTTGGATGTTACGTTGAAATTGGTATGC
GTGCAGTCATTTTAGTTTGTCTGCTGCCTCTAAATAAAGCCTGTTATTTTTTTTTCTTTC
AGTGGACCTTGAGTGGTTTTTGTGTTTCCATGGGTCTAGCCTGGCAAATAAAATGAGCCC
TGAGAGTTTGCTGTCATGGGATCTGCCCAGCTTAGTTTGACAATTTGCCTAATGCCGCCA
CATTGCATAGTTCAGGGAAGAAAACTCAGCCTCACACACACTAGCCATCTTAACGTTGCT
GATCGTCATCCAAGCCTAAGTACACGGTCGCCCTTTTTTCGCGCACATCAACTATCGCCA
GTGAATTCTGTGTCCACTTAAGTAACTCCAGTTTGTAGGGCATCTTAAGTTCAAACATAC
TTGGACTAAAAGTTCATCTTGGTAGGCATACACTATTATATCTGAGCATTAATTTAAGGA
AGTGGAGTCACTCAAACACCGTACTTAGTAGTTCATCTCCAGAGAAGCACATTTAAAATC
TCAGAGAAGTCAGGTGGGGACTAAGATGAAGTAGTTGCAGCAGGTAAGTAAGCTTTTCCA
GAAGATCTGCTCTACAGCTGAGGTCACCATGAGTTGGCAGCCATCATGCATTAGCTCATT
GCACCGGTCTTGGCAGGCAAGTGTCAAACGTCTGCAGAGAACAGACTTGTATGTGCATNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved